Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 5199 citations for Human Amylin Amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Human GAA coding sequence variant GILTco2-m was designed using GeneArt codon optimization algorithm (Thermofisher Scientific). The human GAA coding sequence variant GILTco3-m was designed using a consensus sequence (CCDS32760.1) ...
-
bioRxiv - Bioengineering 2021Quote: ... Human Embryonic Kidney (HEK) 293T cells were grown in Glutamax Dulbecco’s Modified Eagle Medium (DMEM) (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2020Quote: ... or mouse anti-human CD31 (eBiosciences) followed by Donkey Anti Rat-IgG-Alexa FluorTM 594 (Invitrogen), or Goat Anti Mouse-IgG-Alexa FluorTM 594 (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: Human Peripheral Blood T (hPBT) cells have been cultured in RPMI 1640 medium (Thermo Fisher 21875) supplemented with 10% Fetal Bovine Serum (Thermo Fisher 10270) ...
-
bioRxiv - Genetics 2020Quote: Human embryonic stem cells H7 (WiCell WA07) were maintained in feeder-free E8 system (ThermoFisher A1517001). Differentiation of the ES cells to vascular smooth muscle cells was conducted as previously described38 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The human NSCLC cell lines were grown in RPMI-1640 medium (Gibco, Thermo Fisher Scientific, France) and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... The human NSCLC cell lines were grown in RPMI-1640 medium (Gibco, Thermo Fisher Scientific, France) and the human colon adenocarcinoma cell lines were cultured in DMEM medium (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100nM of siCTL or the Human DDX5 siRNA pool were mixed with Lipofectamine 3000 (L3000001, Invitrogen) in Opti-MEM medium according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Neural Stem Cells (hNSC) were obtained from ThermoFischer Scientific (Gibco™, ref#N7800100, H9-derived) and cultured as recommended using KnockOut™ DMEM/F-12 Basal Medium ...
-
bioRxiv - Bioengineering 2020Quote: ... Scaffolds were then incubated with 250 μg/mL human plasma fibronectin (Cat. No. 33016-015; Gibco) overnight at 37 °C to enhance hydrophilicity ...
-
bioRxiv - Biochemistry 2020Quote: Human embryonic kidney cells 293 (HEK293) cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: Copeptin in human plasma was analysed using the KRYPTOR compact PLUS (Brahms Instruments, Thermo Fisher, DE). Glucagon was measured using human glucagon ELISA from Mercodia ...
-
bioRxiv - Microbiology 2020Quote: ... the cells were rinsed with PBS and incubated with goat anti-human Alexa Fluor 488 (Invitrogen). After washing with PBS ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant human TNF-α a well established trigger of HIV-1 reactivation was purchased from Gibco. The PKC activator Bryostatin and Sodium Butyrate (NaBu ...
-
bioRxiv - Microbiology 2020Quote: ... and human embryonic kidney 293 cells (HEK293T) were maintained in Dulbecco’s modified Eagle medium (DMEM, Invitrogen) supplemented to contain 10% heat-inactivated FBS and 1% L-glutamine ...
-
bioRxiv - Microbiology 2020Quote: ... Six μg/mL of goat anti-human H+L conjugated Alexa 488 (Thermo Fisher Scientific A11013) together with 8 μM of antifade-46-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Microbiology 2020Quote: ... falciparum was cultured in vitro in human O+ erythrocytes and RPMI medium (Gibco Cat. no. 11875) supplemented with 5% heat-inactivated human serum ...
-
bioRxiv - Microbiology 2020Quote: Mice engrafted with J-Lat cells were treated with recombinant human TNF-α (Cat. #PHC3011, Gibco), a potent and well-known LRA ...
-
bioRxiv - Molecular Biology 2020Quote: Human lung carcinoma cell line A549 was maintained in Dulbecco’s Modified Eagle Medium (Gibco, 11965-092) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Human hepatoma cells (Huh-7.5) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Invitrogen, Karlsruhe, Germany) supplemented with 10% fetal bovine serum (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: ... Naïve CD8+ cells were plated with Human T-Activator CD3/CD28 Dynabeads (Thermofisher, Cat no.111.31D) at 25 µl of Dynabeads per 1x106 CD8+ cells in complete ImmunoCult cell culture media (see above) ...
-
bioRxiv - Microbiology 2021Quote: 16HBE (human bronchial epithelial cell line) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, GIBCO) with D-glucose ...
-
bioRxiv - Systems Biology 2021Quote: Human lung AEC A549 (ATCC-CCL 185) were maintained in F12K nutrient medium (Thermo Fisher Scientific) with the addition of 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... supernatants were collected and cytokine levels assed with Human IFNγ ELISA Kit (ThermoFisher Scientific, Vienna, Austria) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The human acute leukemia monocyte cell line (THP-1) was cultivated in RPMI 1640 medium (Invitrogen) supplemented with 10% heat-inactivated FBS (Thermo Scientific Hyclone ...
-
bioRxiv - Microbiology 2019Quote: ... The subclass of each IgG antibody was determined using a human IgG subclass ELISA kit (Invitrogen).
-
bioRxiv - Neuroscience 2021Quote: ... human embryonic kidney 293T cells were seeded in DMEM + 10% fetal bovine serum (FBS, Gibco 10099141) + 1x penicillin-streptomycin-glutamine (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary human CD14+ monocytes were maintained in Hank’s Balanced Salt Solution (HBSS, #14175095, Thermo Fisher Scientific) supplemented with 10% FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... and human basic Fibroblast Growth Factor (bFGF) (Thermo Fisher Scientific 68-8785-82, 20 ng/mL). LUHMES cells were grown to 80% confluency and passaged 1:6 using diluted trypsin-EDTA (0.25% ...
-
bioRxiv - Cell Biology 2021Quote: Human epithelial HEK293T (HEK) cells were grown in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2021Quote: Human epithelial HEK293T (HEK) cells were grown in Dulbecco’s modified Eagle’s medium (Gibco, Thermo Fisher Scientific) supplemented with 10% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... MCF10A cells are normal human mammary cells and were maintained in DMEM/F12 media (Gibco, #11330032) supplemented with 5% horse serum ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human breast cancer cell line MCF7 was cultured in DMEM (4500mg/L glucose) (Thermo Fisher) with 10% FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... The ORF of human MYBL2/B-Myb isoform 1 (NM_002466.4) was cloned into pcDNA3.1+ (ThermoFisher Scientific) and fused with an N-terminal Flag tag ...
-
An alternatively spliced TREM2 isoform lacking the ligand binding domain is expressed in human brainbioRxiv - Molecular Biology 2022Quote: HMC3 human microglia or HEK293 cells were transfected with Lipofectamine 3000 with Plus reagent (Invitrogen L3000001) per manufacturer instructions with 0.8 μL of Lipofectamine 3000 ...
-
bioRxiv - Bioengineering 2022Quote: ... Anti-human IL6 Ab concentrations were quantified using the Quant-it protein assay kit (Life Technologies). Ab conjugates were validated on 10% TBE urea denaturing gels and validated on an agarose gel (Supplementary Figure S8) ...
-
bioRxiv - Neuroscience 2022Quote: Huh7 human hepatocellular carcinoma cells were grown in DMEM/F-12 1:1 medium (Thermo Fisher) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mouse-anti-human H3K9/14/18/23/27ac (Thermo Fisher Scientific, Carlsbad, CA, USA; 1:500) was used to detect this histone modification in HPdLF and goat-anti-Mouse-Cy5 (Jackson ImmunoResearch ...
-
bioRxiv - Immunology 2022Quote: ... APC anti-human CD25 (17-0259-42) and 2-NBDG (N13195) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... with detection of the complex with goat anti–human IgG Fab (200 µg/well; Invitrogen, #31122).
-
bioRxiv - Neuroscience 2022Quote: The human Tara coding sequence was amplified by PCR and cloned into the pPC97 vector (Invitrogen). Host Saccharomyces cerevisiae strain MaV203 cells were co-transformed with pPC97-Tara and human fetal brain cDNA library plasmids cloned in pPC86 (GibcoBRL) ...
-
bioRxiv - Genomics 2022Quote: ... mTESR1 is exchanged with the addition of 5 ng/ml Recombinant Human BMP4 (Fisher Scientific, 314BP010). Exposure to BMP4 triggers differentiation of cells and is considered 0 hours for experimental purposes ...
-
bioRxiv - Genomics 2022Quote: Beating human iPSCs were switched to Opti-MEM™ Reduced Serum Medium (ThermoFisher Scientific, Waltham, MA). LINC000881 knockdown was achieved by lipofectamine based transfection of antisense LNA GapmeRs designed against LINC00881 versus scrambled oligonucleotide (QIAGEN ...
-
bioRxiv - Genomics 2022Quote: ... Beating human iPSCs were switched to Opti-MEM™ Reduced Serum Medium (ThermoFisher Scientific, Waltham, MA). LINC000881 overexpression was achieved by lipofectamine based transfection of LINC00881 plasmid versus bacterial alkaline phosphatase control plasmid using RNAiMAX reagent (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... CD4+ T cells were isolated using a commercial kit (MagniSort Human CD4+ T Cell Enrichment; Affymetrix) and infected by incubation for 4 h at 37°C with 156,250 or 2,500 TCID50 (50% tissue culture infectious dose ...
-
Nucleoli and the nucleoli-centromere association are dynamic during normal development and in cancerbioRxiv - Cell Biology 2022Quote: The RD human rhabdomyosarcoma cell culture line was acquired from ATCC and cultured in DMEM (Gibco) with 10% Fetal Bovine Serum (Hyclone ...
-
bioRxiv - Cell Biology 2022Quote: Human A549 and mouse LUAD cells were cultured in high-glucose DMEM (Life Technologies #11965-092) supplemented with 10% FBS and 1% penicillin/streptomycin (“full DMEM” ...
-
bioRxiv - Immunology 2022Quote: ... The secreted fusion protein was purified on a CaptureSelect™ human albumin affinity matrix (Life Technologies), and protein eluted by adding 20 mM Tris and 2.0 M MgCl2 ...
-
bioRxiv - Bioengineering 2022Quote: ... CD8+ T cells were positively enriched by Magnisort Human CD8+T cell positive selection Kit (Invitrogen). Nuclear fraction was isolated using NE-PER Nuclear and Cytoplasmic extraction kit (ThermoFisher) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...