Labshake search
Citations for Thermo Fisher :
2501 - 2550 of 3282 citations for AKAP3 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... 2 μL of 20 μM siRNA (Genepharma) were mixed in 125 μL Opti-MEM (Gibco, cat. no. 31985070) by vortexing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and HS578T cells with siRNAs using the Lipofectamine RNAiMAX Transfection Reagent kit (#13778150, Thermo Fisher Scientific, MA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... overnight serum-starved (0.5% FBS containing culture media) HUVECs were transfected with siRNAs (20 nM) for siControl (Ambion) or siDrp1 (Sense ...
-
bioRxiv - Cancer Biology 2024Quote: ... siRNA knockdown mixture was prepared using a cell-line optimized concentration of Lipofectamine RNAiMAX (cat 13778075-075, Invitrogen) and siRNA (Horizon Discovery ON-TARGETplus ...
-
bioRxiv - Cell Biology 2024Quote: ... rn.Ri.Scamp3.13.3 #613664207 (si#2), and a non-targeting siRNA (TriFECTa DsiRNA, Lot #0000865210) complexed with Lipofectamine 2000 (ThermoFisher) following manufacturer protocols at a concentration of 10 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... The BUB1 plasmids or siRNA with plasmids were transfected with Lipofectamine 2000 (Catalog No. 11668500, Thermo Fisher Scientific) per manufacture’s protocol.
-
The HUSH epigenetic repressor complex silences PML nuclear bodies-associated HSV-1 quiescent genomesbioRxiv - Microbiology 2024Quote: Transfections of hFC with siRNAs was performed using Lipofectamine RNAiMAX and following the supplier’s procedure (Thermo Fisher Scientific). The following siRNAs were used at a final concentration of 40 nM for 48 h ...
-
bioRxiv - Physiology 2024Quote: ... SC or Lgr4 siRNA-transfected INS1 cells treated with 10µM/ml Bromodeoxyuridine (BrdU) (Thermo Fisher Scientific, Milwaukee, WI) for 2h were stained for BrdU with a primary anti BrdU antibody (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... Myotube cultures were transfected with control or XBP1 siRNA (SantaCruz Biotechnology) using Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... Reverse siRNA transfection was performed 72 hours prior to irradiation using Lipofectamine RNAiMAX (Invitrogen Thermo Fisher Scientific, 13778150) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... or 30 nM miR-9 mimic (miRVana; cat# 4464066) or 20 nM control fluorescent BlockIT siRNA (Thermo Fisher) to monitor the transfection efficiency ...
-
bioRxiv - Cancer Biology 2021Quote: ... Transfection mixes were prepared using 0.25 nM siRNA and 2.5 μL Lipofectamine RNAiMAX Transfection Reagent (Cat# 13778075, Life Technologies) to a total volume of 500 μL transfection mixture in Opti-MEM Reduced Serum Media (Cat# 31985-062 ...
-
bioRxiv - Cancer Biology 2021Quote: 4×105 cells were reverse transfected with 25 pmol siRNA using Lipofectamine™ RNAiMAX transfection reagent (ThermoFisher Scientific, 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Transfections of NIH-3T3 cells with siRNA targeting mouse Tmed2 (Fwd: CACCUCUAAUUGAAUUGAACAAGCA, Rev: UGCUUGUUCAAUUCAAUUAGAGGUGAU) were performed with RNAiMax (Invitrogen). The Negative Control DsiRNA (IDT ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated with 40 nM siRNA and 4μL for CPT1A KD and 5 μL for DRP1 KD RNAiMAX in OptiMEM (Gibco) for 4–5 hours ...
-
bioRxiv - Cell Biology 2020Quote: Near-confluent (80-90%) MEFs were transfected with 150 nM lamellipodin or Rac1 siRNAs using Lipofectamine 2000 reagent (Invitrogen) in reduced serum Opti-MEM as previously described [1 ...
-
bioRxiv - Molecular Biology 2021Quote: For siRNA transfection experiments: HEK293 cells were grown in 6-well plates and RNAimax transfection reagent (Invitrogen #13778-150) was used following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 25 pmol of siRNA were mixed with 5 µL of Lipofectamine RNAiMAX in 500 µL of Opti-MEM (Invitrogen) in a 6-well plate ...
-
bioRxiv - Molecular Biology 2019Quote: ... Controls included mock transfections and transfection of 50 nM double-stranded siRNA oligo labeled with Alexa Fluor 555 (Invitrogen, Fredrick ...
-
bioRxiv - Biochemistry 2022Quote: ... Each siRNA (25 nM) was transfected into HEK293T cells by transfection with the Lipofectamine RNAiMAX reagent (Thermo-Fisher Scientific). The cells were then transfected with an XBP1s-luciferase reporter in which the firefly luciferase gene is fused to the XBP1 gene (Spiotto et al ...
-
bioRxiv - Cell Biology 2019Quote: ... Mklp2 depletion in hTERT-RPE1 cells was achieved 72 h after transfection of siRNA oligonucleotides using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were reverse-transfected with 1pmol/10nM of each siRNA in 96-well plates using Lipofectamine RNAiMAX (Life Technologies) and Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were seeded in 24-well plates to be transfected with 30 pmol KHSRP siRNA (Silencer Select, Thermo Fisher) or non-targeting scramble siRNA using 2 μl Lipofectamine 2000 (Invitrogen ...
-
CUX1 and IκBζ mediate the synergistic inflammatory response to TNF and IL-17A in stromal fibroblastsbioRxiv - Immunology 2019Quote: Fibroblasts were transfected with an siRNA by reverse transfection at 30 nM using the RNAi Max reagent (Life Technologies) in 10% FBS containing media ...
-
bioRxiv - Developmental Biology 2021Quote: Two BCAM-targeting siRNAs (siBCAM #1, siBCAM #2; Dharmacon) were transfected into CT29 hTSCs using Lipofectamine RNAiMAX (Thermo Fisher) at a concentration of 100 nM ...
-
bioRxiv - Cancer Biology 2020Quote: ... Stealth RNAiTM siRNAs Negative Control, Med GC and human Il11, NM_000641.3 (HSS179893, HSS179894, HSS179895) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... Alternatively, for cell apoptosis experiments, Mig6 siRNA (Mig6 ON-TARGET plus Smartpool, Dharmacon) was transfected with Lipofectamine 2000 (Invitrogen) to suppress Mig6 expression ...
-
bioRxiv - Physiology 2020Quote: ... cells were seeded at 50% confluency and forward transfected with siRNAs (30 pmol) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA) according to manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2021Quote: ... transfected with respective siRNAs (200 pmol/ well) on day 2 and day 4 using oligofectamine (Invitrogen; 10 μl/ well), and processed on day 6 for IFM or biochemical analyses ...
-
bioRxiv - Cancer Biology 2020Quote: ... D-001810-10-20) was used also at a concentration of 600 nM (both siRNAs from Dharmacon, Thermo Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... 2011) was applied using 15 nM control siRNA (BLOCK-iT Alexa Fluor red or green fluorescent oligo, Invitrogen, USA) and 30 nM Dnmt1 siRNA ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 and 3 (100 pmol for each) or control siRNA were transfected into HeLa cells using Lipofectamine 2000 (Invitrogen). 48 h after transfection ...
-
bioRxiv - Microbiology 2021Quote: ... HEK cells were transfected using Lipofectamine 2000 according to different siRNA quantity in Opti-MEM medium (Thermo scientific, USA). The transfected cells were infected with either CHIKV strains PS or IS with MOI 0.1 at 24 hours post transfection (hpt) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The siRNAs at a concentration of 5 nM were reverse transfected using Lipofectamine RNAiMAX transfection reagent (Invitrogen, VIC, Australia) according to the manufacturer’s protocol ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: SiRNAs were obtained from GenePharma (Shanghai, China) and transfected using the lipofectamine 3000 Transfection Kit (ThermoFisher Scientific, #L3000-015). ShRNA oligos were purchased from TSINGKE Biological Technology (Beijing ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNAs (80 nM in serum free medium) and the Lipofectamine RNAiMax transfection reagent (Thermo Fisher Scientific, Cat. No: 13778075) (12 μg/mL in serum free medium ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... were transfected with 0.35–1.5 µg of total plasmid DNA and optional 45 pmol siRNA using Lipofectamine 2000 Transfection Reagent (ThermoFisher, 11668030) and incubated for 18-48 h ...
-
bioRxiv - Biochemistry 2022Quote: ... which was carried out using INTERFERin following the manufacturer’s instructions (Polyplus Transfection) and 40 pmol siRNA: RAD52 (cat# AM16708) was purchased from Ambion and Control (5’- AUGAACGUGAAUUGCUCAA −3’ ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 µL of 20 µM siRNA and 5 µL RNAiMAX were diluted in 400 µL OptiMEM (Thermo Fisher Scientific), mixed gently and incubated for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... all cells lines were transfected 2x at 0h and 24h with 20nM of indicated siRNAs using Lipofectamine RNAiMax (Invitrogen). After 24h post the second silencing ...
-
bioRxiv - Microbiology 2022Quote: ... specific siRNA (3 μl) and Lipofectamine 3000 reagent (7.5 μl) were added to the Opti-MEM medium (250 μl) (Invitrogen), incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which they were transfected with 15 nM of final siRNA concentrations using Opti-MEM (31985070, Gibco, Dublin, Ireland) and Lipofectamine® 2000 (11668019 ...
-
bioRxiv - Cell Biology 2022Quote: ... The following day cells were co-transfected with 75 pmols HSP70 siRNAs (IDs 145248 and 6965, Thermo Fisher Scientific) using 9 μl Lipofectamine RNAiMAX reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were released from thymidine arrest and transfected with siRNA oligo with RNAi-resistant constructs using Lipofectamine 2000 (Invitrogen). For Bub1 depletion ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were plated in 6 well plates and transfected with 5 μl Lipofectamine RNAiMAX transfection reagent and siRNAs (Invitrogen) at 50 nM final concentration according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Huh-7.5 cells and podocytes were transfected with siRNAs at 10 nM final concentration using Lipofectamine RNAiMax (Life Technologies). All siRNAs were obtained from Dharmacon (siGENOME-SMARTpool).
-
bioRxiv - Cell Biology 2020Quote: ... for reverse transfection on top of a mixture of siRNAs (5nM final concentration) and RNAiMAX (0.04 µl per well in OptiMEM; ThermoFisher) according to manufacturer’s specifications ...
-
bioRxiv - Cell Biology 2019Quote: ... IA32 fibroblasts were transfected at 50% confluency using 25-50 pmol of siRNA and RNAiMAX transfection reagent (Life Technologies) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5X105 cells were reverse transfected with 120 pmol of siRNAs in 6-well plates using Lipofectamine RNAiMAX (ThermoFisher Scientific). Cells were harvested for RNA extraction 72 hours after transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... Cat. No. 4390771) and a Silencer Select Negative control siRNA (Cat. No.4390843) were obtained from Ambion (ThermoFisher Scientific). Astrocytes were plated at a density of 2 X 105 cells/well in a 12-well plate ...