Labshake search
Citations for Thermo Fisher :
2451 - 2500 of 10000+ citations for lefty A TGF beta 4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Sequencing was performed on the Ion Torrent PGM with the Ion PGM Hi-Q View Sequencing kit (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA-Seq templates were prepared using the Ion PGM Hi-Q View OT2 Kit (Thermo Fisher Scientific Inc.) on an Ion OneTouch 2 system ...
-
bioRxiv - Microbiology 2020Quote: 293F cells were transfected by plasmids pOptiVec/V5-His WEAU gp120-trimer using 293fectin according to the manufacturer’s (Invitrogen) instructions ...
-
bioRxiv - Immunology 2022Quote: ... Splenocytes were stored down by resuspending cells in freezing media (HI-FBS with 10% DMSO, Fisher Scientific, BP231-100) in aliquots of 5-10 x106 cells per ml and frozen down to -80°C at a speed of 1°C/min prior to storage in liquid nitrogen.
-
bioRxiv - Immunology 2022Quote: ... and C-terminal foldon trimerization motif followed by hexa-His tag) were used to transiently transfect Expi293F cells (Gibco). Four days after transfection ...
-
bioRxiv - Immunology 2022Quote: ... two alpacas were five times immunized with 200 µg His-NLRP1PYD using Imject™ Alum Adjuvant (Thermo Fisher Scientific) according to locally authorized protocols ...
-
bioRxiv - Immunology 2022Quote: ... The plate was coated with 2 µg/mL mouse anti-His antibody (Invitrogen cat. #MA1-21315-1MG, ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... fused with an N-terminal 6×His-tag and cloned into expression vector pPIC9 (Thermo Fisher Scientific, California, USA). Correctness of the resulting constructs was confirmed by DNA sequencing prior to introduction into Pichia pastoris strain GS115 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was confirmed by western blot using a 6x His-Tag HRP conjugated Monoclonal Antibody (Thermo Fisher Scientific). Once verified ...
-
bioRxiv - Cell Biology 2021Quote: ... reaction mixes were prepared using 2.5 μg recombinant His-ACBD5 with or without the addition of 0.3 mM ice-cold ATP (Thermo Fisher) and 0.1 ug GST-GSK3β (Abcam) ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Biophysics 2021Quote: Detergent extracted His-MBP-tagged proteins were applied to a 40 mL POROS MC 20 Ni2+ column (Applied Biosystems) equilibrated with buffer A (200 mM NaCl ...
-
bioRxiv - Systems Biology 2022Quote: HeLa cells and FUCCI -HeLa cells were cultured in DMEM medium (Hi Media, AT007) supplemented with 10% FBS (Gibco) and 1% Penicillin-Streptomycin (Hi Media, ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate including his-FAP-interacting peptides were collected and submit to a MS facility (Thermo Fisher, Inc.; USA) for analysis ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 228-10481) cDNA was cloned into the BamHI-NotI of the pcDNA3.1(+)-myc-His expression vector (Invitrogen, CAT# V80020) yielding pcDNA3.1-BRCA2T (BRCA2/2662T) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The first round PCR reaction was performed by adding 1 µl of cDNA template to a 20 µl reaction containing 0.005 U of Platinum Taq Hi-Fidelity polymerase (Invitrogen) as previously described (59) ...
-
bioRxiv - Microbiology 2020Quote: ... An aliquot of 50 ng of purified HIV-1 env DNA was used to clone into the pcDNA 3.1D/V5-His-TOPO vector (Invitrogen) and MAX Efficiency Stlb2 competent cells (Life Technology ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Microbiology 2019Quote: Bacterially expressed ZIKV EDIII proteins (C-terminal 6 × His-tag) were conjugated to Ni-NTA Magnetic beads (Thermo Scientific) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... SmBChE1 and SmAChE3 (fSmChEs) were EcoRI/XbaI cloned into the C-terminal 6-His-tagged pPICZαA expression vector (Invitrogen) to facilitate secretory expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific) and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... hLIGHT (L83-V240) and mHVEM (Q39-T142) were separately cloned into the pMT/BiP/V5-His A vector (Invitrogen) and co-transfected into Drosophila S2 cells with the pCoBlast (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... FACS-sorted cells were suspended at 0.5×106 cells/mL in RPMI 1640 medium supplemented with 10% HI-FCS and 1% PenStrep (10378016; Gibco). CD14+HLA-DRneg/low/CD14+HLA-DRhigh monocytes were cultured in 96 well plates (200μL/well ...
-
bioRxiv - Immunology 2021Quote: ... Clonal amplification of the libraries was done using the Ion-PI-Hi-Q Sequencing 200 Kit (Thermo Scientific, USA) PCR emulsions ...
-
bioRxiv - Neuroscience 2023Quote: The plasmid for heterologous expression of fshr-1 in HEK cells was obtained by directionally cloning the fshr-1 cDNA into the pcDNA3.1/V5-His-TOPO vector (Invitrogen). The cDNA sequence of the fshr-1a gene isoform was amplified by PCR using cDNA from mix-staged wild-type C ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant AtGNL-6XHIS was detected using an anti-HIS (C-term)/AP antibody at a 1:2,000 v/v dilution (Invitrogen) and CDP-start ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then incubated for 1 h at room temperature with the following primary antibodies: mouse anti-His-Tag (dilution 1:1,000, clone HIS.H8, Invitrogen MA121315), mouse anti-Flag (dilution 1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... and 15 µL of each eluate was mixed with the same volume of Hi-Di formamide (Thermo Fisher Scientific). Samples were finally sequenced either in one or in both directions on a 3500 Genetic Analyzer device (Applied Biosystems/Hitachi ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Systems Biology 2023Quote: ... and utilized Alt-R CRISPR-Cas9 crRNA/trRNA/Hi-Fi Cas9 ribonucleotide-protein complex (IDT) and Neon electroporation (ThermoFisher) to deliver the complex to the iPSC ...
-
bioRxiv - Plant Biology 2023Quote: ... and proteins were visualized using Ponceau stain as well as Western blot with monoclonal anti-His (Invitrogen MA1-21315), and polyclonal anti-GST (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: ... standard fragment analysis conditions) with 0.8 ul PCR product is loaded in 9.4 ul Hi-Di Formamide (Applied Biosystems), with 0.1 ul GeneScan 500 LIZ (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... Protein detection was performed by incubation with a 6x-His Tag mouse monoclonal antibody (clone: HIS.H8; Thermo Fisher Scientific), followed by a secondary goat-anti-mouse HRP antibody (clone NA9310 N ...
-
bioRxiv - Immunology 2023Quote: ... Proteins containing a His-tag were purified by affinity chromatography using HisPur Ni-NTA resin (Thermo scientific, Cat#88222). Proteins were then eluted with 250 mM imidazole in 50 mM Tris-HCl and 300 mM NaCl ...
-
bioRxiv - Microbiology 2023Quote: ... and gB[H527P]-His EVs was performed at 300 keV on a Titan Krios electron microscope (Thermo Fisher scientific) equipped with a Gatan K3 (5 μm/pixel ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
bioRxiv - Biophysics 2023Quote: ... and the 3C protease was removed using Dynabeads magnetic beads designed for His-tagged protein isolation (Thermo Fisher, 10103D). The supernatant from the magnetic bead pulldown was then concentrated using Amicon 10 kDa centrifugal filter units (MilliporeSigma) ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Sequencing was done using the Ion PI™ Hi-Q™ Sequencing 200 Kit (Thermo Fisher Scientific, Catalog # A26772) on Ion Proton sequencer with sequencing data processing using the Torrent Suite TM Software (Ver ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... mCherry-Emp-V5His construct was cloned using Hifi DNA assembly kit (NEB E5520S into the pAc5.1/V5-His A vector (Invitrogen) using the following enzymes Acc65I and XhoI ...
-
bioRxiv - Immunology 2023Quote: HCMV US18 and US20 were amplified from the HCMV TB40/E BAC (accession #EF999921) and subcloned into pcDNA3.1-V5/His (Invitrogen) via the KpnI/NotI sites to generate pcDNA3.1 US18-V5/His and pcDNA3.1 US20-V5/His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ceSMSγ and ceSMSr cDNAs were PCR amplified and ligated into the copper-inducible pMT/V5-His B vector (Invitrogen).
-
bioRxiv - Biophysics 2024Quote: ... The cDNA was eluted from Dynabeads using 11 μL Formamide-ROX mix (1000 μl Hi-Di Formamide (Thermo Fisher), 8 μl of 350 ROX size standard (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... Amplification and cloning of the truncated versions of TGM4 (D1-3 and D4-5) was performed by PCR amplification using proofreading Taq polymerase Phusion Hi as per the manufacturer’s instructions (Invitrogen), full-length codon-optimised TGM4 as template ...
-
bioRxiv - Microbiology 2023Quote: ... we initially digested the pNL4-3 plasmid with EcoRI and XhoI and subcloned this fragment into pcDNA3.1/myc-His A (Invitrogen). To generate pcDNA3.1 NL4-3 Env TMTR ...
-
bioRxiv - Genetics 2024Quote: ... together with internal size standard ladder where 0.8 µl PCR product was loaded in 9.4 µl Hi-Di Formamide (Applied Biosystems), with 0.1 µl GeneScan 500 LIZ (Applied Biosystems) ...
-
bioRxiv - Biochemistry 2024Quote: ... followed by a 6× His-tag was cloned into the BamHI and XbaI sites of the pcDNA 3.1 vector (#V79020, Invitrogen) containing the vascular endothelial growth factor receptor 1 (VEGFR ...