Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for SKF 83566 hydrobromide CAS 108179 91 5 99% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... cells are incubated with 50 nM LysoTracker Red DND-99 (Thermo Fisher) diluted in culture medium ...
-
bioRxiv - Developmental Biology 2022Quote: Live zebrafish embryos was incubated with LysoTracker Red DND-99 (Invitrogen, L7528) at 10 μM in E3 medium (5 mM NaCl ...
-
bioRxiv - Neuroscience 2022Quote: Reagents and chemicals used were LysoTracker Red DND-99 (ThermoFisher Scientific; L7528), LysoSensor Yellow/Blue DND-160 (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 400 µM 3’-dGTP [>99% purity for UTP and CTP (ThermoFisher); ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase” non-terminated complexes) ...
-
bioRxiv - Neuroscience 2023Quote: ... and LysoTracker™ Red DND-99 (Thermo Fisher, L7528, 1:10,000 dilution). Following a 20-minute incubation (37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then incubated in LysoTracker™ Red DND-99 (ThermoFisher L7528) that was dissolved in room temperature ACSF at a concentration of 1:3000 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with LysoTracker Red DND-99 (Life Technologies L-7528) at 500nM for 45 min at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: For staining with ER-Tracker Red or LysoTracker Red DND-99 (Invitrogen), the dyes were added to the culture prior to fixation or vitrification according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pre-stained with 50 nM LysoTracker Red DND-99 (Invitrogen) for 1 h before infection ...
-
bioRxiv - Immunology 2022Quote: BMMs were incubated with 50 nM Lysotracker Red DND-99 (Thermo Fisher) for 3 hours prior to incubation with LLOMe (Cayman Chemical ...
-
bioRxiv - Cell Biology 2024Quote: ... and LysoTracker™ Red DND-99 (Thermo Fisher Scientific, L7528; 1:5000), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... The cells were stained with 150 nM LysoTracker Red DND-99 (Invitrogen) for 30 minutes in a CO2 incubator ...
-
bioRxiv - Cell Biology 2024Quote: ... LysoTracker experiments were performed by adding LysoTracker Red DND-99 (Invitrogen, L7528) (50 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons were seeded on poly-L-lysine hydrobromide-coated six-well culture plates in Neurobasal Medium (NBM, GIBCO) supplemented with B27 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
mTOR inhibition enhances delivery and activity of antisense oligonucleotides in uveal melanoma cellsbioRxiv - Cancer Biology 2021Quote: ... cells were incubated with LysoTracker Red DND-99 (ThermoFisher Scientific, L7528, 1 µM) for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... The materials used for the solvents were: GC-grade Tributylamine 99% (ACROS ORGANICS), LC/MS grade acetic acid Optima (Fisher Chemical) ...
-
bioRxiv - Microbiology 2021Quote: ... Solvents were purchased from the following vendors: GC-grade Tributylamine 99% (ACROS ORGANICS), LC/MS grade acetic acid Optima (Fisher Chemical) ...
-
bioRxiv - Pathology 2021Quote: ... Solvents were purchased from the following vendors: GC-grade Tributylamine 99% (ACROS ORGANICS), LC/MS grade acetic acid Optima (Fisher Chemical) ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were incubated with 50 nM lysotracker DND-99 (Thermo Fisher Scientific) for 1 hour prior to infection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Solvents were purchased from the following vendors: GC-grade tributylamine 99% (ACROS ORGANICS), LC/MS grade acetic acid Optima (Fisher Chemical) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were incubated with LysoTracker™ Red DND-99 (Thermo Fisher Scientific) for 30 min before image acquisition to visualize the acidic organelles ...
-
bioRxiv - Cell Biology 2021Quote: ... LysoTracker® Red DND-99 and SuperSignal Chemiluminescent substrates were from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSCs were incubated with 70 nM LysoTracker™ Red DND-99 (L7528, Invitrogen) for 1 h at 37°C in culture medium ...
-
bioRxiv - Microbiology 2022Quote: ... SDZ (99%) and AMOX (98%) were purchased from Fisher Scientific (Hampton, NH, USA). ERYTH (94.8%) ...
-
A LRRK2/dLRRK-mediated lysosomal pathway that contributes to glial cell death and DA neuron survivalbioRxiv - Neuroscience 2021Quote: ... or LysoTracker Red DND-99 with anti-fluorescence quenching DMEM (Cat. #A1896701, Gibco). Images were taken by Nikon Spinning Disk at 37°C in 5% CO2.
-
bioRxiv - Biochemistry 2021Quote: HEK-293T landing pad cells 99 were maintained in glucose free DMEM (Gibco) supplemented with 10% heat inactivated FBS (Gibco) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1 mM 3’-d-GTP [>99% purity for UTP and CTP (ThermoFisher); ≥95% purity for 3’-dGTP (Jena Bioscience)] and incubated 2 min at 37°C (to “chase,” and thereby to stabilize ...
-
bioRxiv - Bioengineering 2022Quote: ... and the solution was precipitated into cold (4°C) acetone (>99%, Fisher Scientific). The precipitate was spun down and re-dissolved into DI water ...
-
bioRxiv - Microbiology 2022Quote: ... and cells were incubated with 10 nM LysoTracker Red DND-99 (L7528, Invitrogen) for 1h ...
-
bioRxiv - Microbiology 2024Quote: ... the cells were stained with 150 nM Lyso-Tracker Red DND 99 (Invitrogen). Cells were fixed ...
-
bioRxiv - Cancer Biology 2024Quote: ... cultured cells were stained with LysoTracker Red DND-99 (Invitrogen L7528; 75 nM) at 37 °C for 10 min ...
-
bioRxiv - Bioengineering 2024Quote: ... Increasing doses of acetylcholine (Acetylcholine chloride, 99%, Thermo Fisher Scientific; Waltham, MA, USA) ranging from 10−9 to 10−4 M were administered sequentially through the pressurized luminal loop to probe for endothelium-dependent vasodilatation ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were stained with 150 nM Lyso-Tracker Red DND 99 (Invitrogen). Next ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: A 1/50 dilution of LysoTrackerTM Red DND-99 (ThermoFisher Scientific, L7528, 1mM) was used for lysosome staining of fresh brains ...
-
bioRxiv - Developmental Biology 2024Quote: Staining with LysoTracker (Green DND-26, L7526, or Red DND-99, L7528, Invitrogen), was performed on whole fresh or cultured limbs by incubating them in 1 µM solution for 15 min and then rinsed twice in PBS for 5 min ...
-
bioRxiv - Systems Biology 2024Quote: ... A cell concentration of ∼10,000 cells/μL with >99% GFP+ (Attune, Invitrogen, ThermoFisher) and >90% cell viability (Countess II ...
-
bioRxiv - Systems Biology 2024Quote: ... A cell concentration of ∼10,000 cells/μL with >99% GFP+ (Attune, Invitrogen, ThermoFisher) and >90% cell viability (Countess II ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by incubation with 50 nM LysoTracker Red DND- 99 (Thermo Scientific, L7528) for 15-30 min ...
-
bioRxiv - Bioengineering 2024Quote: ... were measured using IgG Subclass Human ELISA Kit (# 99-1000, Thermo Fisher Scientific) following the product’s instruction.
-
bioRxiv - Neuroscience 2020Quote: ... FIVNC-555p (5’-FAM-CATGGCCACATTAATAATGG CGCA -TAMRA-3’ (Applied Biosystems, CA). These reactions were performed with a Bio-Rad iCyclerTM iQ and analyzed using the manufacturer’s software ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 µM 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Carlsbad, CA, USA); 10 µM 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Cell Biology 2022Quote: ... and blocked with 5% normal goat serum (Life Technologies, Carlsbad, CA) in PBS for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 5 U AmpliTaq Gold polymerase (Applied Biosystems, Foster City, CA), 1× AmpliTaqGold buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... counterstained for 5 min with Hoechst 33342 (Invitrogen, Carlsbad, CA, USA), rinsed with PBST ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of 45 mM dithiothreitol solution (Invitrogen, Carlsbad, CA, USA) were added and incubated for 15 min at 50°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and ABI Quantstudio 5 Detection System (Applied Biosystems, Carlsbad, CA,USA). the reaction volume and conditions were described in previous study (Wu et al ...
-
bioRxiv - Neuroscience 2023Quote: ... CA) on a QUANTSTUDIO 5 Real Time PCR machine (Applied Biosystems). Samples were assayed in duplicate in one run (40 cycles) ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 5% fetal bovine serum (Gibco, Life Technologies, Carlsbad, CA, USA) and 1% Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 5% fetal bovine serum (Gibco, Life Technologies, Carlsbad, CA, USA) and 1% Penicillin-Streptomycin (Gibco ...