Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Mouse Anti Mycoplasma pneumoniae P1 6533 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... rabbit anti-mouse TrkA (Invitrogen, Waltham MA ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-CD43 (Invitrogen, 763493), chicken anti-human IBA1 (Aves Labs ...
-
bioRxiv - Immunology 2023Quote: ... Mouse: anti-CD19 PerCP (Invitrogen), anti-F4/80 PerCP (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... donkey anti-rabbit and goat anti-mouse (Invitrogen). Actin filaments were stained with Alexa Fluor 568-phalloidin (1/50 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... anti-mouse or anti-rabbit (Thermo Fisher Scientific) were used as recommended by manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were probed with mouse anti-HA (12CA5) and mouse anti-Pgk1 (22C5D8, Molecular Probes), followed by probing with mouse anti-Pgk1 (22C5D8 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-mouse IgG/IgM AlexaFluor 488 and anti-mouse IgG/IgG2α AlexaFluor 546 (both Invitrogen) were used ...
-
bioRxiv - Immunology 2022Quote: ... and anti-pp65 antibody (mouse, Argene) combined with goat anti-mouse antibody (AF488, Thermo Fisher), respectively.
-
bioRxiv - Cell Biology 2023Quote: ... Alex Fluor 647 goat anti-mouse and Alexa Fluor 594 goat anti-mouse from Invitrogen. All secondary antibodies were used at a concentration of 1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... Alexa Fluor 350 goat anti-mouse and Alexa Fluor 488 goat anti-mouse IgG (Invitrogen).
-
bioRxiv - Pathology 2023Quote: ... and then with the appropriate secondary antibody (Alex Fluor 488 anti-mouse IgG2b, Alex Fluor 555 anti-mouse IgG2a, or Alex Fluor 647 anti-rabbit IgG; 1:1,000, Invitrogen). Slides were observed using an LSM 710 Zeiss confocal laser microscope ...
-
bioRxiv - Molecular Biology 2021Quote: ... were cultured in mycoplasma-free Dulbecco’s modified Eagle medium (DMEM, Gibco) in a humidified incubator with 5% CO2 atmosphere at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: The cortices of P1-10 mice were dissected into Earle’s Buffered Salt Solution (EBSS; Invitrogen, 14155-063), diced into pieces ~1 mm3 and digested in 0.06 mg/ml trypsin (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... P1 and P2) and were subsequently cloned into the donor vector pDONR221-f1 by BP clonase (Invitrogen) before transfer to pDRf1-GW (Loque et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The pDONRRtl6-3’UTR vector was constructed by the Gateway BP reaction using pDONR221 P1-P2 (Thermofisher) and the Rtl6-3’ UTR fragment ...
-
bioRxiv - Developmental Biology 2021Quote: Primary cardiomyocytes were isolated form P1 pups using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher 88281). H19c2 cells were purchased from ATCC (CXRL-1446) ...
-
bioRxiv - Microbiology 2020Quote: ... the capsid region was amplified by PCR from pCVB3-XhoI-P1-Kpn2I with Phusion polymerase (Thermo Scientific) and primers HiFi-F (CTTTGTTGGGTTTATACCACTTAGCTCGAGAGAGG ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-mouse IgG2B or anti-rabbit antibodies (Life Technologies) were used for immunofluorescence ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 568 in anti-mouse or anti-rabbit (Invitrogen). Coverslips were mounted onto glass slides using ProLong Gold Antifade Reagent (Cell Signaling Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-rabbit or anti-mouse magnetic beads (Thermo Fisher) were conjugated to antibodies ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-rabbit and anti-mouse (1:1000, Molecular Probes) in blocking buffer containing 4ʹ,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Neuroscience 2021Quote: ... They were then rinsed in block for >30 min at room temperature before incubation in secondary antibody (1:250 Invitrogen #A21-42 AF488 anti-mouse IgM; 1:250 Life Technologies #A11029 AF488 anti-mouse IgG1; 1:250 Invitrogen #A21141 AF488 anti-mouse IgG2b) in blocking solution for > 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and secondary antibody (anti-mouse IgG2a AF647, 1:2000, Invitrogen, A-21241; anti-mouse IgG AF568, 1:2000, Invitrogen, A-11031; anti-mouse Cy5, 1:1000), sequentially ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa Fluor 488 anti-mouse IgG or Alexa Fluor 568 anti-mouse IgG (Thermo Fisher Scientific) at 1:500 for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-mouse Alexa A647 (1:1000; goat anti-mouse IgG Alexa Fluor 647; Invitrogen #A21236) for 2h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-CLIMP63 (followed by anti-Rabbit/Mouse/goat Alexa-dye coupled antibodies (1:400, Invitrogen). SiR-lysosome was used to visualize lysosomes in live microscopy (1:2000 ...
-
bioRxiv - Immunology 2020Quote: ... Goat anti-Mouse-(H&L)-Alexa488 and Goat anti-Mouse-(H&L)-Alexa647 secondary antibodies (Invitrogen), Alexa488-conjugated phalloidin (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were incubated in 1:1000 anti-mouse AlexaFluor488 or anti-mouse AlexaFluor594 (Thermo Fisher Scientific) and 4’,6-diamidino-2-phenylindole counterstain (DAPI ...
-
bioRxiv - Cancer Biology 2023Quote: ... and subsequently with fluorophore-labeled anti-mouse (goat anti-mouse Alexa Fluor 488; 1:2000; Invitrogen) and anti-rabbit secondary antibodies (goat anti-rabbit Alexa Fluor 594 ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-mouse-IgG2 Alexa 568 and goat anti-mouse-IgG1 Alexa 488 (1:500, Invitrogen).
-
bioRxiv - Biophysics 2020Quote: ... and anti-mouse Alexa 594 (Invitrogen). Images were captured at room temperature with a Zeiss confocal system (LSM510 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse anti-CD3 (ThermoFisher; 1:200), Rabbit anti-IBA1 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse anti-CD68 (ThermoFisher; 1:100), Rabbit anti-VIM (RayBiotech ...
-
bioRxiv - Cell Biology 2020Quote: ... donkey anti-mouse Alexa647 (Invitrogen; A31571), donkey anti-goat Alexa488 (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-mouse-HRP (Invitrogen, 31430) (1:10,000) ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GAPDH (1:1000, Invitrogen), and rabbit anti-GAPDH (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... goat-anti-mouse IgG HRP (ThermoFisher), and rabbit-anti-rat IgG HRP (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: ... or mouse anti-SAG1 (Thermo Fisher) at a dilution of 1:5000 for 1 hour ...
-
bioRxiv - Biochemistry 2021Quote: ... mouse anti-Pgk1 (22C5D8) (Life Technologies), mouse anti-MBP monoclonal (NEB) ...
-
bioRxiv - Developmental Biology 2021Quote: ... donkey anti-mouse AF488 (Molecular Probes), AF568 conjugated donkey anti-mouse ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-V5 (1:200, Invitrogen), rabbit anti-Cnn (1:500 (Heuer et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-mouse 488 (#A32723; Invitrogen), goat anti-mouse 555 (#A32727 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-mouse 647 (#A32728; Invitrogen), goat anti-rabbit 647 (#A32733 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-mouse 555 (#A32727; Invitrogen), goat anti-rat 555 (#A-21434 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Mouse anti Neurofilament Medium (Thermo Fisher Scientific Cat# 13-0700 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-mouse Alexa488 (Thermo Fisher Scientific Cat# A-11001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-mouse (A11375, Life Technologies), or donkey anti-goat (705-625-147 ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-mouse IgG2a (Invitrogen, A21131), and goat anti-mouse IgG1 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-V5 tag (Invitrogen, R96025), rabbit anti-ZNF598 (Thermo Fischer Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:200; Invitrogen). Directly conjugated mouse anti-α-tubulin-FITC (DM1α ...