Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for IL 5 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and Donkey anti-rat (Invitrogen).
-
bioRxiv - Microbiology 2021Quote: ... goat anti-rat-Alexa594 (Invitrogen), all used at 1:2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... or anti-rat (FITC, Invitrogen) and anti-rabbit (FITC ...
-
bioRxiv - Pathology 2022Quote: ... anti-Rat 488 (A21208, Invitrogen); anti-Rabbit 488 (A21206 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-SOX2 (rat monoclonal; Invitrogen), and Uteroglobin (rat polyclonal ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit and rat (Life Technologies) as secondary antibodies.
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit or rat IgG (Invitrogen).
-
bioRxiv - Bioengineering 2019Quote: ... anti-rat AlexaFluor488 (Invitrogen; A21208), anti-rabbit AlexaFluor488 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... anti-rat AlexaFluor594 (Invitrogen; A21209), anti-rat AlexaFluor488 (Invitrogen ...
-
bioRxiv - Pathology 2020Quote: ... rat α-GFAP (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... and 2% rat serum (Invitrogen) and 2% Armenian hamster serum (Innovative Research ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-Rat 488 (Invitrogen, A21208) and anti-Mouse 488 (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 0.5% normal rat serum (Invitrogen), and 1 µg/ml 2.4G2 (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... rat anti-Ki-67 (Invitrogen), rabbit anti-Ki67 (Cell Signaling Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... 0.5% normal rat serum (Invitrogen), and 1 μg/ml 2.4G2 (BD ...
-
bioRxiv - Immunology 2020Quote: ... mouse/rat (Thermo Fisher Scientific). Quality and amount of RNA were determined using the Qubit RNA BR Assay Kit with Qubit 2.0 (Thermo Fisher Scientific ...
-
Intrarenal B cells integrate in situ innate and adaptive immunity in human renal allograft rejectionbioRxiv - Immunology 2020Quote: ... rat anti-FLAG (ThermoFisher Scientific) was used as the secondary antibody ...
-
bioRxiv - Neuroscience 2022Quote: ... rat monoclonal DAT (Invitrogen, MAB369), and anti-RFP (Takara ...
-
bioRxiv - Neuroscience 2022Quote: ... and mCherry (rat, Thermo Fisher Scientific Cat# M11217 ...
-
bioRxiv - Physiology 2023Quote: ... Rat Kupffer cells (ThermoFisher, RTKCCS) were cultured according to the manufacturer ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat astrocytes (Gibco™, N7745100) were consecutively seeded at a density of 100 cells/mm2 ...
-
bioRxiv - Neuroscience 2022Quote: ... -anti-rat 568 (Invitrogen, #A11004) were used 1:1000 dilution as secondary antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... Rat mCherry 1:1000 (Invitrogen)) ...
-
bioRxiv - Neuroscience 2023Quote: ... rat mCherry (1:1000) (Invitrogen), mouse puromycin (1:1000 ...
-
bioRxiv - Bioengineering 2023Quote: ... rat tail (A1048301, Thermo Fisher); Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-rat AF488 (ThermoFisher A21208)) ...
-
bioRxiv - Microbiology 2022Quote: ... anti-rat-HRP (Invitrogen, #31470), anti-sheep-HRP (A16041 ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-Rat AF 568 (Invitrogen), Anti-Rabbit AF 647 (Invitrogen)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-rat AF488 (Invitrogen, A21208); anti-goat AF488 (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-rat Alexa Fluor546 (Invitrogen) and anti-guinea pig Cy3 (Jackson ImmunoResearch Inc.).
-
bioRxiv - Developmental Biology 2023Quote: ... EpCAM (rat, 1:100, Invitrogen), Sca-1 (rat ...
-
bioRxiv - Immunology 2024Quote: ... Goat anti-Rat Alexa555 (Invitrogen); and Goat anti-Rat Alexa647 (Invitrogen) ...
-
bioRxiv - Neuroscience 2024Quote: ... Rat-GFAP (1:1000, Thermofisher), Rabbit-GFAP (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), and forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL-23p19-AF488 (fc23cpg, Invitrogen); anti-IL-1β-APC (NJTEN3 ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-6 (20 ng/mL, ThermoFisher). To generate human induced pluripotent stem cells (iPSCs) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Cancer Biology 2019Quote: ... 100ng/ml IL-4 (Gibco, USA) for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... caveolin-2 (Thermo Fisher, Rockford, IL), and STIM1/CRACR2A (CRAC regulator 2A ...
-
bioRxiv - Microbiology 2021Quote: ... anti-mouse IL-1β (Invitrogen, # 701304); anti-mouse Cleaved IL-1β (Cell Signaling Technology ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylbenzidine (ThermoFisher Scientific, Rockford, IL, USA) and read at 450 nm according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2020Quote: ... IL-18 Mouse ELISA kit (ThermoFisher), and ELISA MAX Deluxe Set Mouse TNFα (Biolegend) ...
-
bioRxiv - Systems Biology 2022Quote: ... and IL-8 (Invitrogen, catalog # KHC0081) levels in the media samples were conducted according to the manufacturer’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in duplicate by ThermoFisher (Life Technologies Corporation, Chicago, IL 60693) using Z’Lyte (76) ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-8 (ThermoFisher Scientific, catalog # PHC0884), and ChaCha (Anaspec ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-10 (ThermoFisher Scientific, Waltham, MA), and IL-1β (R&D Systems ...
-
bioRxiv - Immunology 2021Quote: ... IL-4 (Invitrogen, #12-7041-41) and Foxp3 (Invitrogen ...