Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with B27 (2% v/v, Thermo Fisher Scientific), GlutaMax (2 mM ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1% (v/v) 2-Mercaptoethanol [all from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% (v/v) B27 (ThermoFisher Scientific, cat.#17504-044) and 3µM CHIR 99021 (GSK3 inhibitor ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2% (v/v) sodium pyruvate (Fisher Scientific Ltd, 113600399), and 1% (v/v ...
-
bioRxiv - Molecular Biology 2024Quote: ... supplemented with 2% v/v B27 (Gibco, Cat# 17504044), 1% v/v GlutaMAX (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... once seeded on to the DCL structure media was changed to DMEM (high) containing 2% v/v horse serum (HS, ThermoFisher Scientific, MA, USA). Use of this media was defined as “differentiation conditions”.
-
bioRxiv - Microbiology 2020Quote: ... Asexual parasites were cultured in human blood (UK National Blood Transfusion Service) and RPMI 1640 medium containing 0.5% w/v AlbumaxII (Invitrogen) at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were then treated with human serum containing phospholipase D (Australian Red Cross Lifeblood) or 0.25% (w/v) Albumax II (Gibco) and incubated for 3 hours at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.15% (v/v) Tween-20 and protein inhibitors (Thermo Fisher) were used to prepare cell lysates ...
-
bioRxiv - Molecular Biology 2020Quote: ... protein was transferred (Blot Module Set, Thermo Fisher Scientific) onto 0.2 μM nitrocellulose (Amersham Protran Premium ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the pelleted bacteria re-suspended in 2ml of SET buffer (65% v/v molecular grade H2 O (ThermoFisher); 20% v/v Tris (pH8) ...
-
bioRxiv - Immunology 2021Quote: ... the concentrations of human IL-2 and IFN-γ were measured using a IL-2 Human Uncoated ELISA Kit (Thermo Fisher) and IFN-γ Human Uncoated ELISA Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... containing streptavidine-CY3 Zymax (1/1000, v/v; CAT#438315, Life Technologies). The slices were then washed in PBS 0.01 mM before mounting onto slides in Fluoromount medium (Cliniscience) ...
-
bioRxiv - Biophysics 2020Quote: ... containing 10% (v/v) Hyclone characterized fetal bovine serum (FBS) (Thermo Scientific), and penicillin (100 IU/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... containing 10% (v/v) heat-inactivated fetal bovine serum (Gibco; Waltham, MA) and maintained at 37°C/5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... and containing 10% (v/v) heat-inactivated fetal bovine serum (Gibco, 16140071) and 1X penicillin-streptomycin (Gibco ...
-
bioRxiv - Biophysics 2022Quote: ... 28,32 Concentration of TALI(23-I23)’s MOTH domain was determined using the Pierce™ BCA Protein Assay Kit (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: The IL-2 ELISA was performed using the IL-2 Human ELISA Kit by ThermoFisher scientific according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2024Quote: ... The supernatant containing nuclear proteins was measured for protein concentration using Pierce BCA Protein Assay Kit (Thermo Scientific) and stored at -80°C until use ...
-
bioRxiv - Microbiology 2023Quote: ... followed by an incubation with mouse anti-human E-cad cytoplasmic domain mAb (4A2C7, Life Technologies). In some experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... B27 (2%, v/v; Thermo Fisher; cat. No. 12587-010), Y27632 (10 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2% B27 without Vitamin A (v/v, Gibco, Cat#12587010), 0.025%insulin (v/v ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 2% (v/v) fetal bovine serum (FBS, Gibco) and passing the resultant cell suspension over a 70μm cell strainer (BD Falcon) ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 2% (v/v) fetal bovine serum (FBS; Gibco) and 1% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were fixed with 2% v/v paraformaldehyde (ThermoFisher Scientific). All antibodies were titrated to optimal concentration before experiments were performed ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2% (v/v) 1 M HEPES (ThermoFisher Scientific, #15630080).
-
bioRxiv - Systems Biology 2024Quote: ... 2 mM L-glutamine,1% (v/v) penicillin/streptomycin(Gibco)) and 2 million cells were seeded in 6cm collagen I-coated dish (BD BioCoat) ...
-
bioRxiv - Neuroscience 2024Quote: ... with 2% (v/v) Proteinase K (Thermo Fisher Cat. #QG0517), mechanically disrupted using a Geno-Grinder® (SPEX Sample Prep) ...
-
bioRxiv - Biochemistry 2021Quote: ... and resuspended in plating medium (Dulbecco’s modified Eagle’s medium (DMEM)/medium 199 [4:1 (v/v)]) containing 15% (v/v) foetal calf serum (FCS; Life Technologies) and 100 U/ml penicillin and streptomycin ...
-
bioRxiv - Immunology 2020Quote: ... were cultured for 16 h in each well of a 12 well plate in serum-free medium (MEM Glutamax, containing 1% v/v Penicillin-Streptomycin and 1%v/v sodium pyruvate [Gibco, Thermofisher]). SARS-CoV-2 clinical samples (100 TCID50/ well ...
-
bioRxiv - Molecular Biology 2023Quote: ... and HeLa cells were cultured in DMEM containing 10% (v/v) FBS and 1% (v/v) Penicillin/Streptomycin (all from Gibco) at 37 °C and 5% CO2 in a humidified atmosphere ...
-
bioRxiv - Cell Biology 2022Quote: ... CuAAC reaction was set up following the instructions from the Click-iT Protein Enrichment Kit (Invitrogen, C10416), but with the provided beads substituted for azide agarose beads (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were precipitated in 70% (v/v) ethanol (Thermo Fisher Scientific) overnight at - 20 °C before centrifuging at 3,220 xg for 1 h and collecting the resulting pellet.
-
bioRxiv - Neuroscience 2021Quote: ... After washing with PBS containing 0.001% (v/v) Tween-20 (Thermo Fisher Scientific), slides were incubated with antibody dilutant (1 % (w/v ...
-
bioRxiv - Bioengineering 2021Quote: ... This cell line was grown in DMEM containing 10% (v/v) FBS (Gibco), 1% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... and PI) containing 1% (v/v) Triton X-100 (TX-100) (Thermo Scientific), and left on ice for 1 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were incubated with growth media containing 10% (v/v) PrestoBlue (Invitrogen). The reduction of PrestoBlue reagent was measured on a Tecan Sunrise Plate Reader at four time points post incubation (10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were incubated in blocking solution containing 10% (v/v) horse serum (Invitrogen) in 0.1M PB with 0.3% (vol/vol ...
-
bioRxiv - Bioengineering 2022Quote: ... containing 10 v/v% foetal bovine serum (FBS) (Gibco® by Life Technologies) and 2 v/v% Penicillin Streptomycin (Pen-Strep ...
-
bioRxiv - Bioengineering 2022Quote: ... containing 10 v/v% foetal bovine serum (FBS) (Gibco® by Life Technologies) and 2 v/v% Penicillin Streptomycin (Pen-Strep ...
-
bioRxiv - Cell Biology 2022Quote: ... and containing 10% (v/v) heat-inactivated fetal bovine serum (Gibco; Waltham, MA). Cultures were kept at a density of 0.2–1.0 million cells/mL at 37°C/5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... containing 10% (v/v) fetal bovine serum (FBS; catalog no. 10270-106, Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin (PS ...
-
bioRxiv - Cancer Biology 2022Quote: ... medium containing 10% (v/v) heat inactivated fetal calf serum (HI-FCS; Gibco), 100 U/mL Penicillin (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... containing 10% (v/v) fetal bovine serum (FBS; catalog no. 10099-141C, Gibco), 100 U ml−1 penicillin and 100 μg ml−1 streptomycin (PS ...
-
bioRxiv - Bioengineering 2023Quote: ... containing 10% (v/v) fetal bovine serum (FBS; catalog no. 10099-141C, Gibco), 100 U/ml penicillin and 100 μg/ml streptomycin (PS ...
-
bioRxiv - Systems Biology 2024Quote: ... containing HEPES and L-glutamine supplemented with 5% (v/v) horse serum (ThermoFisher), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Developmental Biology 2023Quote: Two sets of Protein G Dynabeads (Thermo Fisher Scientific, 10004D) were washed twice with 1ml ChIP dilution buffer (16.7 mM Tris-HCl pH 8.1 ...
-
bioRxiv - Immunology 2020Quote: ... were cultured for 16 h in each well of a 12 well plate in serum-free medium (MEM Glutamax, containing 1% v/v Penicillin-Streptomycin and 1%v/v sodium pyruvate [Gibco, Thermofisher]). SARS-CoV-2 clinical samples (100 TCID50/ well ...
-
bioRxiv - Plant Biology 2023Quote: ... the dried peptides were dissolved in 20 μL of 2% (v/v) acetonitrile (ACN) containing 0.1% (v/v) formic acid (FA) and injected into an Easy-nLC 1200 (Thermo Fisher Scientific). Peptides were separated on a C18 nano HPLC capillary column (NTCC-360/75-3 ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...