Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for Human Immunodeficiency Virus P24 Protein HIV 1 Clade C since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Cellular RNA was mixed with TaqMan Fast Virus 1-step Master Mix (Applied Biosystems), 10 mM forward and reverse primers and 2 mM probe ...
-
bioRxiv - Immunology 2023Quote: ... Concentrated virus was then incubated using 1:2000 DiD-Cell labelling solution (ThermoFisher V22887) for 20 mins at 37°C ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were conducted with TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems), forward primer in the 5’ leader region and gene-specific probes and reverse primers as follows ...
-
bioRxiv - Immunology 2023Quote: ... PCR reactions were conducted with TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems), forward primer in the 5’ leader region and N gene-specific probe and reverse primer as previously described47:
-
bioRxiv - Microbiology 2023Quote: ... containing 5 µl of template and TaqMan Fast Virus 1-step mastermix (Applied Biosystems). Primer sequences and concentrations and thermal cycling conditions for SARS-CoV-2 nucleocapsid 1 gene were as previously described (13) ...
-
bioRxiv - Microbiology 2021Quote: ... HIV cDNA was amplified with TaqMan gene expression master mix (Applied Biosystems, 4369016), J1 FWD (late RT F)— ACAAGCTAGTACCAGTTGAGCCAGATAAG ...
-
bioRxiv - Microbiology 2021Quote: ... phCMV-VSVG and HIV gag-pol in the presence of Turbofect (Life Technologies) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR analysis of intracellular HIV-1 RNA was performed using PowerUp SYBR Green Master Mix (Applied Biosystems, Foster City, CA). Primer sequences used for the detection of HIV-1-RNA and β-actin gene are listed in table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... HIV-1-infected primary CD4+ T cells were stained with AquaVivid viability dye and cell proliferation dye eFluor670 (Thermo Fisher Scientific) and used as target cells ...
-
bioRxiv - Microbiology 2020Quote: ... to quantify total and integrated HIV-1 DNA was performed as described previously (48) using TaqMan™ Universal PCR Master Mix (ThermoFisher). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Drug resistance testing spanning protease (PR) and reverse transcriptase (RT) had been performed using Sanger Sequencing with the Applied Biosystems HIV-1 Genotyping Kit (ThermoFisher Scientific). We obtained the most recently generated residual nested-PCR amplicons tested and since amplicon volumes were limited ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were transferred to a nitrocellulose Hybond-C membrane (Invitrogen). The membrane was blocked in PBS-T milk 5% and probed by using anti-Flag (Sigma F1804 ...
-
bioRxiv - Microbiology 2021Quote: ... Ten-fold serial dilutions (1×10−1 to 1×10−6) of virus stocks were prepared in MEM (supplemented with 25 mM HEPES (Gibco), 2mM L-Glutamine (Gibco) ...
-
bioRxiv - Plant Biology 2021Quote: ... and incubated for 1 h at 4°C with 40 μL of Protein AG UltraLink Resin (Thermo Fisher). The beads were washed 2 × 5 min in ChIP Wash Buffer 1 (0.1% SDS ...
-
bioRxiv - Plant Biology 2021Quote: ... for 1 h with gentle rotation at 4°C and then protein-G coated magnetic beads (Thermo Fisher) were added and incubated for an additional 30 min ...
-
bioRxiv - Plant Biology 2020Quote: ... and incubated for 1 h at 4°C with 40 µL of Protein AG UltraLink Resin (Thermo Scientific). The beads were washed 2 × 5 min in ChIP Wash Buffer 1 (0.1% SDS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:2 diluted whole cell extract in buffer C was added to Dynabeads Protein G (Thermo Fisher Scientific) pre-incubated with HEXIM1 antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vesicular stomatitis virus glycoprotein-pseudotyped virus was produced by co-transfecting 293T cells using Lipofectamine 2000 (Invitrogen) with an shRNA transducing vector and 2 packaging vectors ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell lysates containing 1 mg of protein were incubated with anti-HA antibody (1:100) for 1 h at 4 °C followed by incubation with Protein G Dynabeads (Thermo Fisher Scientific) for 1 h at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells were treated with antibodies (100 or 10 nM) for 1 h at 4°C and then stained Alexa647-conjugated goat anti-human IgG (Invitrogen, A21445) for 0.5 h at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... the membrane was incubated O/N at 4°C with gentle agitation with 1:2000 goat anti-human complement C3 antibody (Thermo Scientific) diluted in 1X TBS/0,5% Tween/3% BSA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 4 °C) and the total protein concentration determined by BCA protein assay (Pierce BCA Protein Assay Kit, Thermo Scientific, 23225) following manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: The pCMV-c-JUN-MYC plasmid was generated by cloning the human c-JUN coding sequence in the pCMV-MYC plasmid (ThermoFisher). Primers used for generation of the construct are shown in supplementary table S5 ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl of virus was immediately mixed with 25 μl of serially diluted (2×) protein A/G purified IgG (ThermoFisher) from mouse sera (starting at 500 μg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein with the C-terminal Fc-fusion was affinity purified with protein-A sepharose (Invitrogen). Samples were eluted with 0.1 M glycine pH 3.0 directly to a neutralizing buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-human (ThermoFisher, 1:1000). Hoechst staining (ThermoFisher ...
-
bioRxiv - Genomics 2022Quote: ... or human cot-1 (15279011, ThermoFisher), and 0.6 μl of 100 μM TIME-Seq hybridization blocking primers (IDT) ...
-
bioRxiv - Microbiology 2022Quote: ... 1:2,000 goat anti-human (Invitrogen), 1:1,000 goat anti-mouse (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Human ApoE protein was quantified using the Invitrogen Human ApoE ELISA following the manufacturers guidelines (Invitrogen. Cat no. EHAPOE).
-
bioRxiv - Molecular Biology 2019Quote: ... cells (in-house stock regularly tested to be virus- and mycoplasma-free) were grown at 25°C in S2 cell media supplemented with 10% fetal bovine serum (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... Virus heat inactivation at 56 °C for 30 minutes and total RNA including virus RNA extraction was performed using TRIzol™ Plus RNA Purification Kit (ThermoFisher, USA). cDNA synthesis was performed using GoScript™ Reverse Transcription System (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... qPCR was performed using the TaqMan™ Fast Virus 1-Step Master Mix (Applied Biosystems). Assays were conducted on a QuantStudio5 Q-PCR machine (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The assay was performed using the TaqMan® Fast Virus 1-Step Kit (Life Technologies) and kit manual ...
-
bioRxiv - Neuroscience 2021Quote: ... using TaqMan Fast Virus 1-Step Master Mix (PN4453800, Applied biosystems, Thermo Fisher Scientific, USA). PrimerTime primers and FAM-dye coupled detection probes were used for detecting Clstn3 mRNA level ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 μL of purified virus was analyzed with the Quant-it PicoGreen dsDNA Assay (Invitrogen).
-
bioRxiv - Immunology 2022Quote: ... For these assays we used TaqMan Fast Virus 1- Step Master Mix (ThermoFisher, catalog # 4444432) and custom primers/probes targeting the E gene sgRNA (forward primer ...
-
bioRxiv - Neuroscience 2021Quote: ... using TaqMan Fast Virus 1-Step Master Mix (PN4453800, Applied biosystems, Thermo Fisher Scientific, USA). PrimerTime primers and FAM-dye coupled detection probes were used for detecting Clstn3 mRNA level ...
-
bioRxiv - Microbiology 2019Quote: Concentrated virus aliquots were mixed with DiI (final concentration of 1 μM, Thermo Fisher, USA), vortexed and incubated for 1.5 h at room temperature (RT) ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR reactions were performed using TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and 5 µl of isolated RNA as a template to detect a 132 bp sequence in the ORF1b/NSP14 ...
-
bioRxiv - Microbiology 2022Quote: ... qPCRs were set up using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher) and run on an ABI 7500 Fast Real-time PCR System (Applied Biosystems/Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... RT-PCR was performed with TaqMan Fast Virus 1-Step Master Mix (Invitrogen, cat. 4444434) in QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher) ...
-
bioRxiv - Immunology 2023Quote: ... vRNA was reverse transcribed using the TaqMan Fast Virus 1-Step qRT-PCR kit (Invitrogen) and quantified on a LightCycler 480 instrument (Roche ...
-
bioRxiv - Neuroscience 2019Quote: FLAG-tagged human LRRK2 proteins were enriched from injected rat striatum using Protein G-Dynabeads (50 µl; Invitrogen) pre-coupled with mouse anti-FLAG-M2 antibody (5 µg ...
-
bioRxiv - Immunology 2021Quote: ... Virus was titrated by adding serial dilutions of virus supernatant (8 replicates) on VeroE6 cells in DMEM (Gibco) containing 2% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Mice were anesthetized with ketamine-xylazine and infected intranasally with 5,000 PFU of the non-recombinant virus or 1,000 PFU of the recombinant virus in 50 μl of Dulbecco’s Modified Eagle Medium (DMEM) (Gibco). For antibody treatment ...
-
bioRxiv - Molecular Biology 2021Quote: ... HIV unspliced mRNA was thenlabelled with a set of 40 probe pairs against the GagPol region of the vRNA (catalogue number GagPol HIV-1 VF10-10884, Thermo Fisher Scientific) diluted 1:5 in diluent provided in the kit and hybridized to the target mRNA for 2 hours at 40°C ...
-
bioRxiv - Microbiology 2021Quote: ... mRNA was labelled with a set of 40 probe pairs against the GagPol region of the vRNA (catalogue number GagPol HIV-1 VF10-10884, Thermo Fisher Scientific) diluted 1:5 in diluent provided in the kit and hybridized to the target mRNA for 2 hours at 40°C ...
-
bioRxiv - Microbiology 2020Quote: ... was generated for each subject from 2,000 HIV-1 RNA copies by RT-PCR using SuperScript™ One-Step RT-PCR (Invitrogen, Carlsbad, California) followed by amplification using GoTaq colorless Master Mix (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... before being used for qPCR analysis using primers that amplify U5-R on HIV-1 and the SYBR green master mix (Thermo Fisher Scientific). ΔΔCt was calculated relative to total histone H3 levels and expressed as fold change relative to cells not expressing a viral protein and infected with WT HIV-1 in the bar graphs.
-
bioRxiv - Cell Biology 2019Quote: ... The samples were then rinsed with PBS (5 × 3 min) and incubated for 1 h at 37°C with the following secondary antibodies: anti-human Alexa 488 (Thermo Fisher, Waltham, MA, USA; 1:750) or anti-mouse Alexa 488 (Thermo Fisher ...