Labshake search
Citations for Thermo Fisher :
201 - 250 of 3282 citations for GRIK5 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... and Silencer Select siRNAs (Ambion) into THP-1 monocytes using methodology adapted from manufacturer instructions for RNAi transfection ...
-
bioRxiv - Microbiology 2024Quote: ... and Pin1 siRNA (s10546, Thermofisher) were used in transfection experiments ...
-
bioRxiv - Cell Biology 2023Quote: MRL MSC were transfected overnight at subconfluence (45%) with 20mM of control siRNA (siCTL) or the siRNA against PLOD2 (siPLOD2) (Silencer® Pre-designed siRNA, Ambion, Life Technologies™) using Oligofectamine reagent (Life Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... The small interfering RNAs (siRNAs) targeting RNF2 and the control siRNA (siControl Non-targeting siRNA #2, Dharmacon®) were purchased from Thermo Scientific (Brebières, France) and were introduced into cells by using Lipofectamine RNAiMax (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: CPT1A siRNA (AM16708) and its negative control Non-coding siRNA (AM4611) were purchased from ThermoFisher. DRP1 siRNA (SI02661365 ...
-
bioRxiv - Pathology 2022Quote: HAECs were transiently transfected with EGR1 siRNA (#s4538, Ambion Silencer Select siRNAs, Thermo Fisher Scientific) and negative control siRNA (#4390843 ...
-
bioRxiv - Immunology 2019Quote: Occludin-specific siRNA and control siRNA were designed and synthesized by Invitrogen (Thermo Fisher, USA). All primers are listed in Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... The Silencer™ Select Pre-Designed siRNA for human BAHD1 (Thermo Fisher 4392422, siRNA # s22604) was ordered and used per vendor’s guideline.
-
bioRxiv - Cancer Biology 2021Quote: ... PLK1 siRNA (s449) or non-targeting control (NT) siRNA (AM4636) was purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 50pmol of siRNA (AccuTarget™ Genome-wide Predesigned siRNA, Bioneer) with OPTIMEM medium (Gibco) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Control siRNA (4390843) and CEP128 siRNA pool (L-032761-02) were purchased from Life Technologies and Dharmacon ...
-
bioRxiv - Cancer Biology 2022Quote: ... YBX siRNA (siYBX) or negative control siRNA (siC) using lipofectamine 3000 (Invitrogen, San Diego, CA) according to manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: ... The AHDC1 siAHDC1 used was a Stealth RNAi™ siRNA (siRNA ID: HSS146954, Thermofisher Scientific).
-
bioRxiv - Pathology 2019Quote: ... and siRNAs (scrambled control and PERK-targeting siRNA) were purchased from Thermo Fisher (Waltham, MA). GSK2606414 was purchased from Apexbio (Houston ...
-
bioRxiv - Cell Biology 2019Quote: MCF-10AT1k.cl2 cells were reverse transfected with the oligo siRNA libraries (siRNA Silencer Select, ThermoFisher), positive control (LMNB1 ...
-
bioRxiv - Genetics 2020Quote: ... Predesigned Silencer Select siRNA constructs targeting Itgα9 and negative control siRNA were obtained from ThermoFisher. Primary VSMCs were transfected using RNAiMAX transfection reagents according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... cells were transfected with HoxA11 Silencer Select Validated siRNAs or siRNA controls (Ambion, Cat. 4390824) and Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... and control siRNA (Silencer™ Negative Control No. 1 siRNA) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... Either control siRNA (Silencer™ Negative Control No. 1 siRNA, Ambion, Thermo Fisher Scientific, Inc.) or a combination of PTEN siRNA (s325 and s326 ...
-
bioRxiv - Cell Biology 2021Quote: ... Either control siRNA (Silencer™ Negative Control No. 1 siRNA, Ambion, Thermo Fisher Scientific, Inc.) or a combination of PTEN siRNA (s325 and s326 ...
-
bioRxiv - Cancer Biology 2021Quote: ... POSTN (siRNA ID: 20888) and scramble Silencer® siRNA control were purchased from Thermo Fisher Scientific (Rochester ...
-
bioRxiv - Microbiology 2022Quote: ... siRNA SMARTpool) (siRab11) or with a nontargeting siRNA control (siCTL) by using RNAiMax reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... p66Shc-specific siRNAs (custom made) and a non-specific control siRNA were purchased from Invitrogen. An appropriate amount of siRNA was incubated with Lipofectamine2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: siRNA for mouse-IGF1R was constructed in vitro using the Silencer siRNA Construction Kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 1000 nM validated Silencer Select siRNAs against PDK1 (Invitrogen-Themo Fisher Scientific; siRNA ID # s10274), Rictor (Invitrogen-Themo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and were all siRNA resistant against the hALPK1 siRNA (s37074) from Ambion (Thermo Fisher Scientific) (Milivojevic et al ...
-
bioRxiv - Physiology 2023Quote: ... siRNA knockdowns were performed using pre-made siRNA smartpools (Horizon) and transfected with siRNAiMax (Invitrogen). Supplemental studies were conducted in immortalized pig proximal tubule cells (LLC-PK1 ...
-
bioRxiv - Cancer Biology 2023Quote: Silencer select TRAF2 siRNAs (s14380, s14381) and XIAP siRNAs (s1454, s1455) were from Thermo Scientific. 30 nM of siRNA transfections were done using Lipofectamine RNAiMAX (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... A target-specific Silencer® Select siRNA (Thermo Fisher Order Number: 4392420; siRNA ID: s8199) and a corresponding control siRNA (Thermo Fisher Order number ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were transfected with either scrambled siRNA or Flvcr2 siRNA using Lipofectamine 3000 (Fisher Scientific). Flvcr2 knock-down was confirmed by qPCR 48 hours after transfection (Extended Data Fig ...
-
bioRxiv - Molecular Biology 2023Quote: ... The siRNAs were obtained from Silencer Select Pre-Designed and Validated siRNA (Thermo Fisher Scientific): KAT7 siRNA-1 (108177) ...
-
bioRxiv - Cell Biology 2024Quote: ... Silencer Select negative control siRNA and Stealth negative control siRNA were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: Short-interfering RNA (siRNA) experiments were performed with 10 nM siRNA and RNAiMAX Lipofectamine (Invitrogen, 13778150) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: siRNA targeting hEZH2 (ID: s4916 and s4918) and negative control siRNA (AM4635) were from Thermo Fisher Scientific (Silencer Select) ...
-
bioRxiv - Cell Biology 2019Quote: siRNA silencing was performed using 20 nM siRNA oligos and Lipofectamine® RNAiMAX Reagent (ThermoFisher Scientific) according to manufacturer’s protocol and cells were cultured for 3 days before the experiments ...
-
bioRxiv - Molecular Biology 2020Quote: ... cells were transfected with 15 pmol siRNA using RNAiMAX (Invitrogen; 15 pmol siRNA : 2 µL reagent) or 1 µg expression vector using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Systems Biology 2021Quote: ... with 75 nM of DHFR siRNAs or Silencer Select Negative Control-1 siRNA (Ambion, Austin, TX) and nucleofected with the Amaxa nucleofector apparatus using programs C-009 and C-006 ...
-
bioRxiv - Microbiology 2021Quote: ... The following siRNAs were used in this study: Silencer Select Negative Control #2 siRNA (Thermo Scientific) for the control siRNA and s12727 (Thermo Scientific ...
-
bioRxiv - Pathology 2022Quote: ... and negative control siRNA (#4390843, Ambion Silencer Select Negative Control No. 1 siRNAs, Thermo Fisher Scientific) using HiPerFect Transfection Reagent (QIAGEN) ...
-
bioRxiv - Biochemistry 2022Quote: ... siRNA duplexes (siRNA B and C) were transfected into HEK293-PSMB2-HB cells using RNAiMAX (Invitrogen) dissolved in Opti-MEM (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected with 15 pmol siRNA using RNAiMAX (Invitrogen; 15 pmol siRNA: 2 μL reagent) or 1 μg expression vector using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... silencer select siRNA for human FtH1 and negative control siRNA (4392421 and 4390843 respectively, ThermoFisher Scientific) were used ...
-
bioRxiv - Developmental Biology 2020Quote: siGENOME RISC-Free Control siRNA (Dharmacon) and Silencer Select Pre-designed siRNAs against mouse ASPP2 (Ambion) were resuspended in nuclease-free sterile water and used at 20 μM ...
-
bioRxiv - Molecular Biology 2019Quote: ESCs were transfected with the indicated siRNAs (50 nM siRNA) using Lipofectamine® RNAiMAX (Life Technologies) in Opti-MEM® GlutaMAX™ (Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: Reverse siRNA transfections were done using 5 nM Silencer Select pre-designed siRNAs (Thermo Fisher Scientific) with Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... mouse Upf3a siRNAs (50pmol) and Upf3b (50pmol) siRNAs were transfected by lipofectamine® RNAiMAX reagent (Invitrogen) into Upf3a-proficient and Upf3a-deficient mESCs with a previously published reverse transfection method (Li et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... The negative control was non-targeting siRNA (Silencer select no 1 siRNA, cat no – 4390843, Ambion).
-
bioRxiv - Cell Biology 2023Quote: ... siRNA transfections were performed using 50 nM of siRNA using Lipofectamine RNAiMax (13778030, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... three Silencer® Select siRNA oligos specifically targeting YWHAB (Thermo Fisher, siRNA ID: s14961, s14962, s14963) were used ...