Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 7 tert butoxycarbonyl 5 6 7 8 tetrahydro 1 2 4 triazolo 4 3 a pyrazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cancer Biology 2021Quote: Glucose uptake experiments were performed using 2-NBDG (2-(N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxyglucose) (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Glucose was traced using 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, ThermoFisher, cat. #N13195) combined with 0,57 mg/mL 40kDa tetramethyl-rhodamine Dextran (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5-1×10^7 parasitized RBCs were incubated with 4 µM BCECF-AM (B1170, ThermoFisher) and 0.02% Pluronic F-127 (p6867 ...
-
bioRxiv - Genomics 2019Quote: ... An ArrayControl RNA Spots and Spikes kit (with spike numbers 1, 4 and 7) (Ambion) were used to monitor technical variability ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Cell Biology 2024Quote: ... the conversion of non-fluorescent 2’,7’-bis-(2- carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF AM) (Invitrogen, Waltham, MA) into a pH sensitive fluorescent indicator by the intracellular esterase was used to measure the pH ...
-
bioRxiv - Biophysics 2023Quote: ... the media was removed and the cells were incubated with 8 µM CellEventTM Caspase 3-7 green detection reagent (Thermo Fisher) in PBS containing 5% FBS for 30 min at 37 °C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... DynaBead MyOne carboxylic acid (Invitrogen), 1M MgCl2 (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Plant Biology 2019Quote: ... pollinated stigma was incubated in FM™ 4-64 Dye (N-3-Triethylammoniumpropyl-4-6-4-Diethylamino Phenyl Hexatrienyl Pyridinium Dibromide, Life Technologies T3166, 8.23 μM) for five minutes and subsequently washed in 1/2 Murashige and Skoog basal medium containing 10 % (w/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Microbiology 2022Quote: ... infected Jurkat cells were initially preloaded with 5 µM of CellTracker CMAC (7-amino-4-chloromethylcoumarin) (Life Technologies) and cocultured for 6 or 24 h with MDMs plated onto coverslips ...
-
bioRxiv - Bioengineering 2020Quote: ... WT-PGP1 were labeled with 5 μM CellTracker™ Blue 7-amino-4-chloromethylcoumarin CMAC (Molecular Probes, #C2110), iNeuron-PGP1 was labeled with 2.5 μM CellTracker™ Green CMFDA (Molecular Probes ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24 hrs at 1 hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2020Quote: ... Apoptosis was detected using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher). Frames were captured over a period of 24hrs at 1-hour intervals from 4 separate 1.75 x 1.29 mm2 regions per well with a 10× objective using IncuCyte S3 live-cell analysis system (Sartorius) ...
-
bioRxiv - Immunology 2021Quote: ... In vitro derived PCs were stained with CellEvent Caspase 3/7-Green (ThermoFisher), tetrametylrhodamine ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with CellEvent Caspase 3/7 Detection Reagent (ThermoFisher Scientific, cat. no. C10423) to a final concentration of 2 μM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cytotoxicity was assessed using the CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at 1.0 µM and gating on CD45-negative cells ...
-
bioRxiv - Bioengineering 2023Quote: Passage 3 and passage 4 cells from 8 donors (4 male and 4 female) were expanded in T175 flasks (Thermo Fisher Scientific, Hampton, New Hampshire USA) and were cultured until passage 5 (p3-5 and p4-5 ...
-
bioRxiv - Cell Biology 2020Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)amino)-2-deoxy-d-glucose (2-NBDG) was purchased from Invitrogen (Carlsbad, CA, USA). Trypsin-EDTA solution was purchased from GIBCO BRL (Grand Island ...
-
bioRxiv - Genomics 2020Quote: ... 7-Aminoactinomycin D (7-AAD) (1:200 dilution, ThermoFisher Scientific #A1310 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then washed and stained for 20 min at 4 °C with the following antibodies: anti-mouse CD8α APC-efluo780 (clone 53-6-7, ebioscience/ Thermofisher), anti-mouse CD8β AF700 or BUV495 (clone YTS156 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Liver-Chips were stained in the upper channel with 5(6)-Carboxy-2′,7′-dichlorofluorescein diacetate (CDFDA) (Thermo Fisher) to visualize bile canaliculi and MRP2 activity ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Neuroscience 2019Quote: ... cortical cultures were loaded with fluo-4 AM (3 μM) or fura-2 AM (3 μM) plus 0.1% Pluronic F-127 (ThermoFisher) in a HEPES-buffered saline solution (HCSS ...
-
bioRxiv - Microbiology 2021Quote: ... CAS number: 328–42–7), 2-Ketoglutaric acid, disodium salt, dehydrate (>99%, CAS number: 305–72–6) were purchased from Acros Organics, Belgium ...
-
bioRxiv - Immunology 2020Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineeethanesulfonci acid (HEPES; Thermo Fisher), and 1X non-essential amino acids (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... 1X 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) (Thermo Fisher Scientific), 1X MEM non- essential amino acids (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... T-cells were co-cultured with the mCherry-Nucleus-7 MCF7 cells in the presence of CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher, C10423) in 96 well plates ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 10% glycerol) were separated on 3-8% Tris-acetate or 4-12 Bis-Tris gels (Thermofisher). Proteins were then transferred to PVDF membranes (Merck).
-
bioRxiv - Molecular Biology 2019Quote: Whole cell lysates were resolved in NuPAGETM 3-8% or 4-12% gradient gels (ThermoFisher Scientific) and transferred onto PVDF membranes using the Trans-blot Turbo transfer system (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on NuPage 3-8% or 4-12% Bis-Tris precast gels (ThermoFisher Scientific) and transferred to nitrocellulose ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s protocol and visualized using FITC 488 nm filter ...