Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 6 Quinoxalinecarboxaldehyde 1 2 3 4 tetrahydro 1 methyl 3 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... then incubated in 4′,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Carlsbad, CA, USA) for 10 minutes and washed with PBS again ...
-
bioRxiv - Developmental Biology 2023Quote: ... Tissues were then stained with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, D1306, 1:5000) for five minutes to visualize DNA ...
-
bioRxiv - Genetics 2024Quote: ... The nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI) (1 μg/mL, Invitrogen) for 5 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by culturing with the neural induction medium supplemented with 20 ng/ml human FGF-2).61 The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated for overnight with primary antibody at 4 degrees and further incubated with secondary antibodies (1:500) for 1 hour followed by 4′,6-diamidino-2-phenylindole (DAPI) or phalloidin 488 (1:400, Thermo Fisher, A12379) staining ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) at 30 °C for 45 minutes ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were infected in a BSL-3 lab with the UF-1 strain of SARS-CoV-2 at MOI of 4 in media containing 3% low IgG FBS (Fisher Scientific, Cat. SH30070.03).
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried material was dissolved in 300 μl of 6:1 (v/v) of methyl sulphoxide D6 (99.9% atom D + 1% tetramethylsilane, ACROS Organics):D2O (100% atom D ...
-
bioRxiv - Neuroscience 2024Quote: ... The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lungs were inflated with 1-3 ml 2% UltraPure Low Melting Point Agarose (Invitrogen). Lungs and livers were fixed overnight at 4°C on a shaker ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2022Quote: ... the samples were added with a DNA-binding dye 4′,6-diamidino-2-phenylindole (DAPI, 1 µg mL-1 in PBS, Invitrogen) and phalloidin conjugated Alexa Fluor dye (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... resuspended in 1 mL NSB with 1:20 dilution of 0.25 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) and FACS sorted ...
-
bioRxiv - Biophysics 2023Quote: ... the samples were added with a DNA-binding dye 4’,6-diamidino-2-phenylindole (DAPI, 1 μg mL-1 in PBS, Invitrogen) along with the secondary antibody solution ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The caspase-3 activity was quantified using EnzChek™ Caspase-3 Assay Kit #1 (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Life Technologies D-21490, 1:2000) for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The nuclear dye 4’,6-diamidino-2-phenylindole (DAPI) at 1 l ng/ml (Molecular Probes) was added to visualise all cells ...
-
bioRxiv - Physiology 2020Quote: ... Cell nuclei were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1:10,000; ThermoFisher, Table S13). Confocal images were acquired using an inverted laser scanning confocal microscope (Nikon Eclipse C1) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, 1:500, Molecular Probes, Eugene, USA) and images were obtained using a scanning confocal inverted microscope (TCS ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were counterstained with 1/2500 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, ThermoFisher Scientific, USA). The cover slips were fixed in fluorescence mounting medium (Fluoromount-G ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA is stained with 1 mg/ul 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher, Carlsbad, CA) 1/10,000 in PBS for 5 minutes and Vectashield mounting medium is applied (Vector Labs ...
-
bioRxiv - Cell Biology 2019Quote: ... DNA is stained with 1 mg/ul 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher, Carlsbad, CA) 1/10,000 in PBS for 5 minutes and Vectashield mounting medium is applied (Vector Labs ...
-
bioRxiv - Bioengineering 2019Quote: ... Sections were also counterstained with 4′,6-diamidino-2-phenylindole (DAPI; 1:1000; Invitrogen, cat. #D1306). Immunocytochemical images were acquired with a confocal microscope (Olympus FV1000 Laser Scanning Confocal ...
-
bioRxiv - Cell Biology 2019Quote: ... also confirmed by 4′,6-diamidino-2-phenylindole fluorescent dye (DAPI, 1:1000, Molecular Probes, USA) staining.
-
bioRxiv - Immunology 2021Quote: ... Chamberslides were then incubated in 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (1:5,000, ThermoFisher Scientific) in 1x PBS for 5 min ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Karlsruhe, Germany, 1:100) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 4′6-diamidino-2-phenylindole (DAPI, nuclei staining, 1:10000; Cat. no. D1306, Life Technologies) diluted in PBS for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides then were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) or with YOYO-1 (ThermoFisher). When HPV probe signal co-localized with YOYO-1 signal detecting DNA at 63x magnification ...
-
bioRxiv - Bioengineering 2022Quote: ... counterstained with 1 μg/mL of 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, #D1306) for 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed and stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D3571, 1:4000) in PBS for 10 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Bioengineering 2019Quote: ... TOPRO-3 (1:1000, in PBS) (Invitrogen, USA) was used for 15 min at room temperature to stain the nuclei.