Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen, Waltham, MA, USA) was added to the cells ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated in 5-ethynyl-2’-deoxyuridine (EdU; ThermoFisher A10044) dissolved in K-SFM (20 mM final concentration ...
-
bioRxiv - Physiology 2024Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of 5× SYPRO orange (Life Technologies, Eugene, Oregon, USA) and 2.5 µl of the resuspended array compound or the equivalent amount of buffer in the ligand-free control ...
-
bioRxiv - Systems Biology 2024Quote: ... 2) Blocking buffer: wash buffer with 5% BSA (Thermo Fisher, J6509722). Hs27-VPH were transduced with lentiviruses of pRCA360 expressing sgRNA against HES7 ...
-
bioRxiv - Cancer Biology 2024Quote: ... incubated with 5-ethynyl-2′-deoxyuridine (EdU) (Thermo Fisher Scientific, C10636), then stained with a fluorescent CD34 antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... transferred to 5 mL of LB broth (Fisher Scientific, BP1426-2), and incubated shaking overnight at 37℃ ...
-
bioRxiv - Molecular Biology 2021Quote: ... in Minimum essential medium (MEM), glutamine-free based Neuronal growth medium (5% fetal bovine serum, 2% B27, 1% Glutamax (100×, Invitrogen), 2 % 1 mol/L d-glucose ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Cell Biology 2021Quote: ... 2X SSC) for 5 min and counter stained with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies). Coverslips were mounted in imaging buffer (3.7 μg/μl glucose oxidase and 1U catalase in equilibration buffer ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... and suspension diluted 1/5 by adding FACS staining buffer (SB; 2% heat-inactivated Fetal bovine serum (Life Technologies; 26140079), 25 mM HEPES (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... and the suspension diluted 1/5 by adding FACS buffer (FB; 2% heat-inactivated Fetal bovine serum (Life Technologies; 26140079), 25 mM HEPES (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... cells were resuspended at a concentration of 1-2×106/mL in 50-100 µL of cold HBSS containing 5% heat-inactivated FBS (Gibco), 100U/mL penicillin ...
-
bioRxiv - Neuroscience 2023Quote: ... or DIV12 (overexpression) primary hippocampal neurons were transfected with 1-2 μg plasmid DNA and 5 μL Lipofectamine 2000 (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... and the nuclei pellet was resuspended in 2 mL of ice-cold resuspension buffer (1 M HEPES [#J16924- AE, ThermoFisher Scientific]; 5 M NaCl [#01094764, ThermoFisher Scientific] ...
-
bioRxiv - Microbiology 2022Quote: ... the robot adds 2 volumes of 30% PEG 6000 (in 1.6 M NaCl) and 35ul of 1:5 diluted Glycoblue (Invitrogen, Thermo Fisher) to each well ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Bioengineering 2024Quote: ... and splenocyte to resuspend post centrifugation for 5 minutes and subsequently diluted with 5mL ice-cold FACS Buffer (2 or 10% FBS in 1× HBSS (Gibco) or 1X PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... Digestions were incubated for 1 hour at 37 ℃ and then diluted 1:5 with UltraPure water before loading on E-gel EX 2% Agarose gels (Invitrogen). Backbones were purified using the Monarch Gel Extraction Kit (Monarch) ...
-
bioRxiv - Microbiology 2023Quote: ... Staining of DNA was performed on fixed cells by incubating them for 5 min in a 1 μg/ml 4,6-diamidino-2-phenylindole (DAPI, 62248, Thermo Fisher) solution ...
-
bioRxiv - Biophysics 2023Quote: ... 300 mL NaCl, 5 mM imidazole, 10% glycerol, 0.2 mM 2-mercaptoethanol, 1 mM PMSF, and Pierce Protease Inhibitor Tablets [Thermo Fisher]). Cells were sonicated for 5 min (30% amplitude ...
-
bioRxiv - Biochemistry 2023Quote: ... the buffer was exchanged to HBS buffer (1×HBS pH 7.2, 5% (v/v) glycerol) by gel filtration (Zeba Spin Desalting column, 2 mL, Thermo Fisher). For immunoblotting ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Bioengineering 2023Quote: ... cells were stained for 10 min in 0.5 µL/mL calcein-AM and 2 µL/mL ethidium homodimer-1 from the Live/Dead assay kit (L3224, Invitrogen). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by 1–2 weeks of selection with fresh medium containing 200–500 μg/ml Hygromycin (Invitrogen, ant-hg-5). The surviving cells were released from the well with 0.05% Trypsin–EDTA (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: C2C12 cells were magnetically labelled by an incubation with a solution of iron oxide nanoparticles at [Fe] = 1 - 2 mM and 5 mM citrate in RPMI 1640 medium (Gibco) for 30 minutes leading to an uptake of about 3 pg of iron per cell (measured by magnetophoresis) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2020Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B-27-RA (Thermofisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1× 2-mercaptoethanol (Life Technologies), 100 U/ml penicillin/100μg/ml streptomycin (Life Technologies) ...
-
bioRxiv - Genetics 2021Quote: ... 1% N-2 Supplement (Gibco), 2 mM L-glutamine (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: ... 1% N-2 supplement (Gibco), 2% B-27 supplement (Gibco) ...
-
bioRxiv - Genomics 2020Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B27-RA (Thermofisher ...
-
bioRxiv - Genomics 2020Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B27-RA (Thermofisher ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 % N-2 (Thermo Fisher), 2 % B-27 (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... 2 mM GlutaMAX-1 (Gibco), 500× Primocin (InvivoGen) ...
-
bioRxiv - Immunology 2020Quote: ... 2 mM GlutaMAX-1 (Gibco), 100 U/ml penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B-27-RA (Thermofisher ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B-27-RA (Thermofisher ...
-
bioRxiv - Bioengineering 2024Quote: ... 1% N-2 supplement (Gibco), 1% B-27 supplement (Gibco) ...
-
bioRxiv - Biophysics 2023Quote: ... N-2 (1:100) (GIBCO), 10 mM nicotinamide (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% N-2 supplement (Gibco), 1% GlutaMAX supplement (Gibco) ...
-
bioRxiv - Genetics 2024Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B-27-RA (Thermofisher ...
-
bioRxiv - Genetics 2024Quote: ... 1% N-2 (Thermofisher, #17502048), 2% B-27-RA (Thermofisher ...