Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 3' Chloro 3 3 chloro 5 fluorophenyl 4' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... or 4 µM TO-PRO-3 Iodide (TOPRO, Thermo Scientific). Acrosomes were visualized using 0.5 µg ml-1 lectin peanut agglutinin (PNA) ...
-
bioRxiv - Microbiology 2024Quote: ... 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine 4-chlorobenzenesulfonate salt (DiD; Invitrogen). IAV sizes were determined via dynamic light scattering (DLS ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Microbiology 2023Quote: ... 5-[3-aminoallyl]-2’-deoxyuridine-5’-triphosphate (aminoallyl-dUTP, Thermo Scientific™) was incorporated into a PCR by the use of a DreamTaqTM DNA Polymerase (Thermo Scientific™ ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Scientific, 22980) were added to the alginate solution in a molar ratio of 1 alginate:30 NHS:25 EDC ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 x 5 min with PBS (Gibco #14200-067) and fixed with 4 % (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded in microglia differentiation medium with 3 μM Fluo-4 AM and 3 μM Fura-Red AM (Molecular Probes) in the presence of Pluronic Acid F-127 (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocks of tissue of ~3×3×4 cm (depth×width×height) were cut and prepared for sectioning using a Vibrating Blade Microtome (Thermo Fisher) at a thickness of 500μm ...