Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 2' 5' Dichloro 3 3 4 dimethylphenyl propiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... adding 3 mL HPLC grade methanol and 2 mL HPLC grade chloroform (C297-4, Thermo Fisher Scientific), then shaking at 22°C for 1 hr ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the reverse primer containing the Sp6 promoter (5’ ATTTAGGTGACACTATAGCCTCTTCAGTTCCTTCTTCCATC-3’).The aqp1a.1 probe was generated from whole extracted cDNA at 30hpf and amplified with the primers (5’-GTCATGAACGAGCTGAAGAGC-3’) and (5’-GGGTCACTTTGAGGACATCTC-3’),incorporated into the pCR-BluntII-TOPO vector (Invitrogen, 45-0245) (containing both the SP6 and T7 promoters) ...
-
bioRxiv - Genomics 2020Quote: ... The 16S rRNA gene was amplified from the extracted genomic DNA using 16S universal primers 27F (5’-AGA GTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTTC-3’) and sequenced using an automated ABI3730XL capillary DNA sequencer (Applied Biosystems, USA) for taxonomic identification at Cosmo Genetech (Seoul ...
-
bioRxiv - Microbiology 2020Quote: ... 229E-RP reverse primer (5’-CCAACACGGTTGTGACAGTGA-3’) and the TaqMan minor groove binder (MGB) probe 229E-TP (FAM-5’-TCCTGAGGTCAATGCA-3’-NFQ-MGB; Thermo Fisher Scientific), derived from the HCoV 229E membrane protein gene sequence as described previously (Vijgen et al. ...
-
bioRxiv - Microbiology 2021Quote: The mcr-1 gene was amplified from the clinical isolate ESBL20150072 (European Nucleotide Archive, accession number; SAMEA104060671) using primers: 5’-TTTTGGATCCCGGTTTTCGGGCTTTTTA-3’ and 5’-ATATGTCGACTCAGCGGATGAATGCGGT-3’ and Phusion polymerase (Thermo Fisher Scientific). PCR product was digested with BamHI and SalI and ligated into pACYC184 digested with the same enzymes (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... PCSK9 mRNA expression was assessed by real-time PCR using PCSK9 primer sets 5’-TGTCTTTGCCCAGAGCATC-3’ and 5’-GTCACTCTGTATGCTGGTGTC-3 (Integrated DNA Technologies) and SYBR Select Master Mix (ThermoFisher, ABI 4472908).
-
bioRxiv - Genetics 2022Quote: ... 5’-GGCAAGCUGACCCUGAAGUdTdT-3’ / 5’-ACUUCAGGGUCAGCUUGCCdTdT-3’ or with a hsa-miR-34a mimic duplex: 5’-P-UGGCAGUGUCUUAGCUGGUUGUU-3’ / 5’-P-CAAUCAGCAAGUAUACUGCCCUA-3’ according to the protocol for Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... a fragment containing 2.21 kb upstream regulatory region of ELF3 was amplified from Col-0 genomic DNA using primers ELF3Prom-Fw (5’-CACCCTTATAAATAAAATTCC-3’) ELF3Prom-Rv (5’-CACTCACAATTCACAACCTTTTTC-3’) and cloned into the Gateway System (pENTR™ Directional TOPO® Cloning kit, Invitrogen) to obtain the pELF3-TOPO plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... Drosophila dSF2 sequence was PCR amplified (dSF2 F 5’-CACCATGGGATCACGCAACGAGTGCCG-3’ and dSF2 R 5’- ATAGTTAGAACGTGAGCGAGACCTGG-3’) was cloned into pEntry-TOPO vector (Thermo Fisher Scientific). The pENTR-dSF2 vector was recombined with Gateway plasmid pTWH (Drosophila Genomics Resource Center ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... The 16S rRNA gene was amplified with the primers 8f (5′-AGAGTTTGATCCTGGCTCAG-3′; Weisburg et al. 1991) and 1520 r (5′-AAGGAGGTGATCCAGCCGCA-3′; Edwards et al. 1989) (Invitrogen, CA, USA). A volume of 0.5 μL DNA extract was used for 50 μL PCR reactions containing 2 units Taq DNA polymerase ...
-
bioRxiv - Molecular Biology 2024Quote: ... Expression of Kdm5c was detected us-ing the primers 5’-CCCATGGAGGCCAGAGAATAAG-3’ 5’-CTCAGCGGATAAGAGAATTTGCTAC-3’ and nor-malized to TBP using the primers 5’-TTCAGAGGATGCTCTAGGGAAGA-3’ 5’-CTGTGGAGTAAGTCCTGTGCC-3’ with the Power SYBR™ Green PCR Master Mix (ThermoFisher #4367659).
-
bioRxiv - Cancer Biology 2024Quote: ... sequence is 5’-GCCGACCAAUUCACGGCCG-3’ and siRNA directed against GNA11 (siGNA11) is 5’-AAAGGGUACUCGAUGAUGC-3’) using Lipofectamine™ RNAiMAX (13778150, Fisher Scientific) and harvested 48 h post-transfection.
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μM of 20-base model RNA (5’-AAUCUAUAAUAGCAUUAUCC-3’; ThermoFisher Scientific) was treated with 300 nM of purified recombinant SARS-Cov2 NSP13 with an N-terminal His-tag (Cayman Chemicals #30589 ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... with the primers pZE21-for (5’-GACGGTATCGATAAGCTTGAT-3’) and pZE21-Pbla-rev (5’-GACTCTTCCTTTTTCAATATTATTGAA-3’) and subsequently dephosphorylated using FastAP (Thermo Fisher Scientific, USA). This approach allowed efficient library preparation and screening for mobilized novel resistance determinants ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a lentiviral transfer plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher Scientific L3000015). Viral supernatant was harvested 48h after transfection and filtered through 0.45 µm cellulose acetate filters (Corning 431220) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Bioengineering 2024Quote: ... VSV-G expression plasmid and pUC19 plasmid (2:3:4 ratio by mass) using Lipofectamine 3000 (Thermo Fisher). The media was changed 6 hours post-transfection and was collected for downstream processing 48 hours post-transfection.
-
bioRxiv - Molecular Biology 2023Quote: The RNA of 500 µL iRBCs at 3-5% parasitaemia was isolated using 3 mL TRIzol reagent (Invitrogen) followed by phenol-chloroform phase separation ...
-
bioRxiv - Bioengineering 2020Quote: ... 3) latrunculin-b (Lat-B; 2 μM; Fisher Scientific), 4 ...
-
bioRxiv - Neuroscience 2021Quote: ... passaged 1:2-3 when confluent using Tryple (ThermoFisher). When thawing or passaging the iPSCs ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM 2-deoxy-D-glucose (2DG; ACROS Organics), 2 μM PERK inhibitor (PERKi ...
-
bioRxiv - Microbiology 2024Quote: ... glass (2 gm, 3 mm bead diameter; Fisher Scientific) and polystyrene (24-well plates ...
-
bioRxiv - Plant Biology 2022Quote: ... 2–3 μg were treated with Turbo DNase (Ambion). RNA was circularized using T4 RNA ligase and reverse transcription was performed with the Superscript III (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse-anti-desmocollin-2/3 7G6 (1:250, Invitrogen 32-6200 ...
-
bioRxiv - Neuroscience 2022Quote: ... dissociated with Accutase for 3-4 minutes (Fisher Scientific #A1110501), collected via centrifugation ...