Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Cancer Biology 2024Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Invitrogen)
-
bioRxiv - Genomics 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher, 62248); Acetic acid (Sigma-Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies), using Alexa Fluor 594 anti-insulin (Life Technologies ...
-
bioRxiv - Physiology 2024Quote: ... DAPI (4′, 6-diamidino-2-phenylindole, Thermo Fisher, 62248), Hoescht 33342 (Thermo Fisher ...
-
bioRxiv - Microbiology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (ThermoFisher, D1306) was used at a 1:300 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) for 1h at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal (Thermofisher, 8312-4) were placed on each before mounting a coverslip ...
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell nuclei were stained with 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000, Invitrogen, Thermo Fisher Scientific, MA) for 10 mins ...
-
bioRxiv - Cell Biology 2024Quote: ... 1:2000 LipidTOX was added along with 0.25 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes) for 15 min ...
-
bioRxiv - Physiology 2023Quote: ... the sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI; D1306, Thermo Fisher Scientific; 1:1000 in PBS) for 2min at room temperature to counterstain the nucleus before being washed twice in PBS ...
-
bioRxiv - Plant Biology 2024Quote: DAPI (4′,6-diamidino-2-phenylindole) solution: Dilute 1 mg/ml DAPI (ThermoFisher, Cat. No. 62248, Rockford, IL, USA) to a final concentration of 0.5 µg/ml in 1x PBST (0.1% Tween-20).
-
bioRxiv - Developmental Biology 2023Quote: ... Cell pellets were finally resuspended in wash buffer containing 1 µg/ml 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) or 7-AAD viability dye (BioLegend ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’ ,6-diamidino-2-phenylindole; cat. no. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Physiology 2024Quote: ... Slides were then stained with DAPI (1:10,000; 4’, 6-diamidino-2-phenylindole; Cat. No. D3571; Thermo Fisher Scientific) for 10 minutes at room temperature and mounted with glass coverslips using 1:1 PBS and glycerol as mounting medium ...
-
bioRxiv - Developmental Biology 2022Quote: ... and incubated with Alexa-Flour-488 or 555 secondary antibodies (1:1000) along with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Camarillo, CA, 1:1000) for 1 hr at room temperature (RT) ...
-
bioRxiv - Biochemistry 2023Quote: ... NaHCO3 and 150 μL acetone containing 4 mg/mL 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (L-FDAA, Thermo Scientific) was added ...
-
bioRxiv - Bioengineering 2024Quote: ... The cells were split (at 1:6) every 4 to 5 days by treatment with Accutase (Thermo/Life Technologies; A1110501). The minimize cell loss ...
-
bioRxiv - Immunology 2024Quote: ... anti-ɑ-tubulin (B-5-1-2; Invitrogen), Alexa Fluor 488 anti-acetylated tubulin (6-11B-1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1∼5 mM in the Fluo-4(F14201, Invitrogen) form of Powder ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.173% 2-methoxy(polyethyleneoxy)propyltrimethoxysilane (Gelest, SIM6492.7) and 0.62% n- butylamine (Acros Organics) with flowing nitrogen gas for 90 minutes ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... DNA and F-actin were counterstained for 20 min in the dark with 1 μL/ml 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) and Alexa Fluor 647 phalloidin (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were washed three times with PBS and nuclei counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI) (#D3571, Invitrogen) in PBS for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibodies were applied in incubation buffer (1:500 in PBS/BSA) with 4‘,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Doublets and dead cells were excluded based on forward scatter (FSC) and side scatter (SSC) and 4′,6-diamidino-2-phenylindole staining (DAPI, 1 µg/ml; ThermoFisher). All depicted flow cytometry plots were pre-gated on non-debris (by FSC and SSC) ...
-
bioRxiv - Microbiology 2021Quote: ... the cells were counterstained in 1 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific GmbH, Bremen, Germany) for 10 min at 46°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Slides were then washed and stained with 1:10,000 DAPI (4=,6-diamidino-2-phenylindole, Thermo Fisher Scientific; catalog #: D3571) for 15 minutes at room temperature before coverslips were applied using PBS + glycerol as mounting medium.
-
bioRxiv - Cell Biology 2024Quote: ... both at 1:300 dilution and mounted with ProLong Gold antifade reagent with DAPI (4’,6-diamidino-2-phenylindole; Invitrogen). Confocal microscopy (Olympus FLUOVIEW FV3000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and incubated with 0.1% Triton X-100 in PBS supplemented with 4′,6-diamidino-2-phenylindole (DAPI) (1 μg/ml) (Invitrogen, # 62248) for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Enteroids were then washed with PBS three times with the addition of 4’,6-diamidino-2-phenylindole (DAPI) nuclear stain (1:5000) (Invitrogen) for the final 10 min wash ...
-
bioRxiv - Microbiology 2024Quote: ... blocked with 2% BSA in a PBS buffer for 10 min and incubated with 0.1–1 μg/ml DAPI (4’, 6-diamidyno-2-fenyloindol, Molecular Probes) and WGA-Texas Red (Wheat Germ Agglutinin-Texas Red ...
-
bioRxiv - Neuroscience 2024Quote: ... before incubation with DAPI (4’,6-diamidino-2-phenylindole, dilactate, 0.1 µg ml−1 final concentration in PB, Invitrogen D3571) in 0.1 M PB for 10–20 mins at RT ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were washed again with PBST and incubated with 4′,6-diamidino-2-phenylindole (DAPI, Molecular Probes, 1:2000 dilution) and phalloidin-tetramethyl rhodamine B isothiocyanate (phalloidin-TRITC ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Immunology 2020Quote: PBMC (1-2*10^6 cells) and pDC (1-4*10^4) were maintained for 16 h in RPMI1640+10% FBS+ 1% (PS) (Gibco Laboratories) in 96 well round bottom plates ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2 phenylindole (DAPI, 1:10000, Fisher Scientific, catalog # EN62248). Microscope slides were cover slipped with Fluro-mount mounting media (Fisher Scientific ...