Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 10000+ citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM glutamine (Gibco, #25030) 25 mM glucose (Sigma Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... and Qubit 4 fluorometer (Invitrogen). Whole genome sequencing was done using the Illumina Nova-seq platform facility (MedGenome ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4% KSR (Invitrogen, 10828028). The medium was changed every two days.
-
bioRxiv - Microbiology 2023Quote: ... 4 μM cytochalasin D (Invitrogen), 1:1000 diluted Annexin V-FITC (BioLegend ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 mM L-glutamine (ThermoFisher) and 1 mM sodium pyruvate (ThermoFisher) ...
-
Functional characterization of ATP13A2 variants associated with distinct neurodegenerative disordersbioRxiv - Molecular Biology 2023Quote: ... fixed with 4% paraformaldehyde (Affymetrix) for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... using 4-well plates (Nunc) at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... formalin (Fisher Scientific SF98-4), SG-209 (T24786 ...
-
bioRxiv - Bioengineering 2022Quote: ... and 4 mM Glucose (Gibco). The enhanced maturation medium 2/1 (EMM2/1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4% Insulin,-Transferrin-Selenium (Invitrogen), 100 U/ml penicillin and 100 U/ml streptomycin (Hyclone ...
-
bioRxiv - Genomics 2023Quote: ... and Qubit 4 fluorometer (Invitrogen), and used 1 ng for DNA library preparation using the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and Qubit 4 fluorometer (Invitrogen). Sequencing was performed on a Novaseq machine (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-well chamber slides (Nunc Lab-Tek II Chamber Slide System ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 mM L-glutamine (Gibco), 0.201 mM cystine (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2023Quote: ... using fluo-4 (Invitrogen F14200) and a commercial calcium calibration buffer (Invitrogen C3008MP) ...
-
bioRxiv - Neuroscience 2023Quote: ... 4 mM Glutamax (Gibco, 35050061) and 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4 μg/mL Puromycin (Invitrogen) was used to select cells ...
-
bioRxiv - Bioengineering 2023Quote: ... 4°C DMEM/F12 (Gibco). Crypts were centrifuged at 4°C for 5 minutes again and resuspended again with 300 μL DMEM/F12 medium ...
-
bioRxiv - Neuroscience 2023Quote: ... or Fluo-4 (F14201 Invitrogen) at 1 µM for 30 minutes or MitoTracker red (M22425 Cell Signaling ...
-
bioRxiv - Molecular Biology 2024Quote: ... and Qubit 4 Fluorometer (Invitrogen). Equal amounts of MboI-digested and Hin1II-digested libraries from both Control and t-2-hex samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... Fluo-4 AM (Life Technologies-Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: FM 4-64 (ThermoFisher, T13320) was used to label hair cells in the crista within the zebrafish inner ear ...
-
bioRxiv - Genomics 2024Quote: ... 4 mM l-glutamine (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 4% PFA (Fisher Scientific) was added to the lungs via intratracheal instillation ...
-
bioRxiv - Genomics 2024Quote: ... 4 mM deoxynucleoside triphosphates (Invitrogen), 1% bovine serum albumin ...
-
bioRxiv - Cell Biology 2024Quote: ... L-glutamine (4 mM, Gibco), sodium pyruvate (1 mM ...
-
bioRxiv - Immunology 2024Quote: ... DispaseII (4 U/ml; Gibco) and 5% FBS was injected into the lung cavity ...
-
bioRxiv - Synthetic Biology 2021Quote: The cell lines SKBR3 and MCF-7 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... All TaqMan analysis was performed using an Applied Bio system’s Viia 7 instrument (Thermo-Fisher Scientific). The results were then exported ...
-
bioRxiv - Cell Biology 2020Quote: Cellular ROS production was measured using a CM-H2DCFDA (2’,7’-dichlorofluorescein diacetate) (Life Technologies, USA) assay kit ...
-
bioRxiv - Immunology 2021Quote: ... 1 × 105 activated NKT cells were incubated with 1 mM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (Invitrogen) in RPMI complete media for 30 minutes at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were then harvested and stained with 7-AAD viability dye and Vybrant DyeCycle Violet (Invitrogen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from the cortices of 7-month-old mice using TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: HeLa (ECACC 93021013) and MCF-7 (ECACC 86012803) cells were cultured in MEM Alpha medium (Gibco), with GlutaMax (no nucleosides) ...
-
bioRxiv - Immunology 2022Quote: ... Frozen tissues were sectioned at 7 μm thick using CryoStar™ NX70 Cryostat (Thermo Fisher Scientific), then fixed in acetone ...
-
bioRxiv - Immunology 2019Quote: ... cells were treated with TURBO™ DNase (12 units/10^7 cells, cat# AM2239, ThermoFisher Scientific) for 1 hour at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... 7 mg of protein were incubated with 343 μM Maleimide-PEG2-biotin (Thermo Fisher Scientific, #21901BID) at room temperature for 30 minutes with agitation by precipitating the alkylated protein with 1 mL of 100% cold acetone by incubating at −20°C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Primer/Probes was run on QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher) with standard settings ...
-
bioRxiv - Cancer Biology 2021Quote: ... live zebrafish larvae (7 dpf) were incubated at 28°C in 2 mM EdU (Invitrogen, #C10340) in E3 medium for 2 h followed by a further incubation in fresh E3 medium for 1 h ...
-
bioRxiv - Neuroscience 2020Quote: ... 9.4% (1.023 g/ml) and 7% (1.017 g/ml) OptiprepTM (1.320 g/ml) (Thermo Fisher Scientific). After centrifugation at 800 x g for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... Nuclei in the actin-stained samples were labeled with propidium iodide (7 µM, Molecular Probes, P3566). The stained samples were kept in PBS and visualized with a confocal laser scanning microscope (Leica TCS SP5X with a 40× /1.1 HCX PL Apo CS lens) ...
-
bioRxiv - Biophysics 2020Quote: ... hiPSCs were dissociated by incubating at 37°C for 7 minutes with TrypLE™ Express (ThermoFisher) and seeded at 125000 cells/cm2 on a Matrigel® coated 12 well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cooled on ice before addition of 7 mL of pre-chilled phenol/chloroform (Ambion) to precipitate proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The viability dyes DAPI and 7-AAD were used where appropriate (BD and Thermo Fisher Scientific). CellTrace Far Red (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... HBEC3-KT cells were incubated with 1 μM of 2’-7’-dichlorofluorescin diacetate (CM-H2DCFDA; Invitrogen) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and plates were read using a QuantstudioTM 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Data was analyzed using the delta-delta CT method to generate box plots for a fold change of gene expression (with a fold change of 1 representing the gene expression of 100,000 hMSCs before seeding on scaffolds and composites) ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...