Labshake search
Citations for Thermo Fisher :
2401 - 2450 of 6549 citations for 6 Chloro N methoxy N methyl nicotinamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...
-
bioRxiv - Molecular Biology 2021Quote: ... cryosectioned zebrafish larvae were washed 3x in wash buffer for 5 min and subsequently stained with Filipin solution for 60 min in a humidified dark chamber and co-stained with BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany). Staining solution was removed and slides were washed twice in wash buffer ...
-
bioRxiv - Molecular Biology 2019Quote: The 2′ O-methyl phosphorothioate AOs were transfected into dermal fibroblasts as lipoplexes using 3 μl of Lipofectamine 3000 (Life Technologies, Melbourne, Australia) per 1 ml of OptiMEM ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were stained with CellTrace BODIPY TR methyl ester (1:200 in PDT [1 % DMSO, 0.1 % Triton X-100 in PBS], cat# C34556, Thermo Fisher Scientific, Waltham, MA) for 20 min at RT and/or DAPI (5 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: The mitochondrial membrane potential was measured using the tetramethylrhodamine methyl ester (TMRM, 50 nM, Life technology, T668) and Mitotracker Green (100nM, Thermo Fisher Scientific, M7514) fluorescent probes according to the manufacturers’ protocols ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was aspirated and the cell pellet was resuspended in 150 μL KCl buffer (for composition, see Ca2+ uptake protocol above) supplemented with 500 nM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher Scientific, I34361) and 0.005% digitonin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firstly proteins were precipitated with 50 μL of acetonitrile followed by steroid extraction via liquid-liquid extraction with 1 mL tert-methyl butyl ether (MTBE, Acros Organics, Fisher Scientific, UK). The MTBE layer was then removed ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... (G4S)6 Linker-VH/CH1 and (G4S)6 Linker-VH/CH1-(G4S)6 Linker-VH/CH1 sequences were synthesized using GeneArt® gene synthesis service (ThermoFisher Scientific).
-
bioRxiv - Immunology 2020Quote: ... Serial frozen sections (6 μm in thickness) were cut on a cryostat and counterstained with DAPI (4′,6-Diamidine-2′-phenylindole; Thermo Fisher Scientific). The number of beads in the SED from 3-4 sections of two Peyer’s Patches per mouse (n=3–4 mice/group ...
-
bioRxiv - Cell Biology 2020Quote: ... Adult cardiac NMCs were isolated from adult C56BL/6 mice (6-8 weeks old) by digesting adult ventricles in buffer containing 1 mg/ml collagenase IV (Gibco 17104-019) and 1.2 mg/ml dispase II (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... cells were seeded in 6-well plates or 6 cm dishes and reverse transfected with 5 nM Silencer Select siRNAs (Thermo Fisher Scientific) using RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: ... iPSC cultures at ~90% confluence in 6-well-plates were treated with 6 μM CHIR-99021 (SelleckChem) in RPMI 1640 medium supplemented with B27 supplements (Thermo Fisher Scientific) for 2 days to induce mesoderm specification ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Biophysics 2020Quote: A 6-well plates (Nalge Nunc International, Roskilde, Denmark) was treated with Poly-L-Lysine (PLL ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Developmental Biology 2021Quote: ... media was changed to Essential 6 Medium (Gibco; A1516401), 24 hours later cells were treated with 200ng/ml FGF8b (PeproTech ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, Eugene, OR, USA). Quantification of GFAP ...
-
bioRxiv - Neuroscience 2019Quote: ... Transient transfection was performed with Fugene 6 reagent (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... with a supplement of 6 mM GlutaMAX (Gibco, 35050061) and 10 ml/l HT supplement 50X (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: Cells were transferred into 6-well plates (Fisher Scientific) for immunoblotting experiments or 35 mm glass-bottom dish (Mattek ...
-
bioRxiv - Cell Biology 2019Quote: ... and 6 mM L-glutamine (#25030-024, Life Technologies). Cell lines used were authenticated and routinely confirmed to be negative for any mycoplasma contamination ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Biochemistry 2020Quote: ... and (ii) 6 μl of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... in 6-well Falcon plates (Fisher Scientific, Cat #087721B). The next day ...
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 μl of PCR enhancer solution (Invitrogen, 11495-017) and dH2O to the final volume ...
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems) was used for thermal cycling at recommended settings ...
-
bioRxiv - Molecular Biology 2020Quote: ... 6 mM L-glutamine (Thermo Fisher Scientific, MA, USA) and antibiotic-antimycotic (100U/ml penicillin ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... in 6-well plates (Fisher Scientific #08-772-49) at room temperature (∼22 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... and QuantStudio 6 Flex Real-Time PCR System (ThermoFisher). Each quantitative RT-PCR assay was repeated 2-3 times ...
-
bioRxiv - Cell Biology 2022Quote: ... DNP (EM 1:6-1:30, #71-3500, Invitrogen), DPP4 (IF/FACS 1:100 ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Genomics 2021Quote: ... Reactions were loaded onto 6% DNA retardation gels (ThermoFisher) and run in 0.5X Tris–borate–EDTA buffer for 2 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cultured on 6-well plates (Thermo Fisher) coated with 1:30 Matrigel (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... 106 MeWo cells seeded in 6-well plates (Nunc) 24 hours previously were transfected with 4µg the pPOKA BACs using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2021Quote: ... or QuantStudio 6 real-time PCR system (Applied Biosystems).
-
bioRxiv - Neuroscience 2021Quote: ... in Essential 6 (E6) medium (Thermo Fisher Scientific, A1516401) supplemented with the SMAD pathway inhibitors dorsomorphin (2.5 μM ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Biophysics 2020Quote: ... 6% deoxy Big-CHAP (Affymetrix Anatrace, Maumee, OH, USA) and SecYEG in detergent (Protein to Lipid ratio of 1:50 ...
-
bioRxiv - Neuroscience 2022Quote: ... coated 6-well plates in Essential 8 medium (Gibco) and were passaged every 3 days using Versene (EDTA-based ...