Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for rno mir 134 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: Specific miRs were reverse-transcribed using the Taqman MicroRNA reverse transcription kit (Applied Biosystems), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... or miR-K6-5p mimic (miRVana) with Lipofectamine RNAiMax (ThermoFisher Scientific, Cat No: 13778150) as instructed ...
-
bioRxiv - Cancer Biology 2019Quote: ... The miR-26a mimic or negative control miRNA (miRNA mimic Negative Control #1, Ambion) was used at a final concentration of 10 nM to investigate the effect of miR-26a on EV secretion ...
-
bioRxiv - Cell Biology 2021Quote: ... Pre-miR-181a-1 in vitro synthesis was performed using T7 MEGAshortscriptTM kit (Ambion) from 1 µg purified DNA and following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... 100 nM of miRVANA miR-184 inhibitor (cat. 4464084, ID. MH10207-Invitrogen, Pittsburgh, US) + 50 nM of CRTC1 siRNA ...
-
bioRxiv - Cancer Biology 2020Quote: mRNA and miR-7704 levels were measured using the TaqMan Fast Advanced Mix (ThermoFisher) and the following TaqMan Assays with FAM/MGB-NFQ primers/probe ...
-
bioRxiv - Developmental Biology 2022Quote: ... We used the mir Vana miRNA Isolation Kit with phenol (Ambion, Austin, TX, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: miRNA mimics of miR-28 and the scramble control sequence were purchased from Ambion. Established DFBL-18689-V2 PDX tumors (> 100 mm3 ...
-
bioRxiv - Cell Biology 2023Quote: ... and small RNAs were enriched by an mir-Vana miRNA isolation kit (Thermo Scientific). Samples were pretreated with homemade PIR-1 or 5’ Pyrophosphohydrolase (RppH ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was synthesized with 100 ng of total RNA using specific stem-loop RT primers and TaqMan microRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA). Real-time RT-qPCR for miRNA was performed using TaqMan Universal PCR Master Mix II (Applied Biosystems ...
-
bioRxiv - Biochemistry 2020Quote: ... MMLV RT (ThermoFisher) and MutiScribe™ RT (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... functional primers with the corresponding probes were tested by qPCR using a StepOne Real-Time PCR instrument (Applied Biosystems). The following reagents were added for a 20 μL reaction mixture ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nick primers were used with SYBR® Green on the Step One plus Real-time PCR system (Applied Biosystems) and normalized to the Ct values obtained within the surrounding ∼300 bp DNA region amplified with the flanking primers (Table S2) ...
-
bioRxiv - Cell Biology 2020Quote: ... Equal amounts of each cDNA were analyzed by real-time PCR with specific primers and PowerUp SYBR Green (Invitrogen) in an ABI QuantiStudio 3 real-time PCR system ...
-
bioRxiv - Neuroscience 2021Quote: ... The resulting cDNA samples were amplified by TaqMan quantitative PCR using commercially available primer/probe kits from Applied Biosystems for BDNF (Gene Expression Assay Mm00432069_m1 ...
-
bioRxiv - Immunology 2021Quote: ... Targeted qPCR was performed using the QuantStudio 6 Real-Time PCR system using the following Taqman Primers (Applied Biosystems): BCL6 (Hs00153368_m1) ...
-
bioRxiv - Neuroscience 2020Quote: ... reacted with one of the PCR primers and the BigDye terminator v3.1 cycle sequence kit (Thermo Fisher Scientific, 4337455), and the gene sequence was identified using a 3130 Genetic Analyzer (Thermo Fisher Scientific).
-
bioRxiv - Plant Biology 2021Quote: ... PR1 expression was detected using primers qPR1_F and qPR1_R by quantitative real-time PCR using Maxima SYBR green mix (Thermo Fisher) and the AriaMx Real-Time PCR system (Agilent Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA (10 ng) was analyzed with gene-specific primers (Table S2) using the StepOnePlus realtime PCR system (Applied Biosystems) and FastStart Universal Probe Master (Roche Applied Science) ...
-
bioRxiv - Molecular Biology 2022Quote: The primers used for real-time PCR were designed using PrimerExpress™ software (Applied Biosystems; see Supplemental Table S3). 800 ng total RNA were reverse transcribed to cDNA using High-Capacity cDNA Reverse Transcriptase kit (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was amplified with two primers for each gene using Power SYBR Green PCR Master Mix (Applied Biosystems, USA) and Real-time PCR analysis was performed using QuantStudio 12K Flex (Applied Biosystems by Life technology ...
-
bioRxiv - Immunology 2020Quote: ... using 10ng of cDNA and 200nM of each specific primer on a 7500 Fast Real-PCR system (Applied Biosystems). cDNA concentration in each sample was normalized to GAPDH expression ...
-
bioRxiv - Microbiology 2021Quote: ... with gene-specific primers according to the manufacturer’s protocol and the Applied Bioscience StepOnePlus qRT-PCR machine (Life Technologies). The expression levels were normalized to the endogenous 18S rRNA expression using the delta-delta comparative threshold method (ΔΔCT) ...
-
bioRxiv - Immunology 2022Quote: ... and gene specific primers according to manufacturer’s instructions on a Quantstudio 3 Real-Time PCR system (Thermo Fisher Scientific). CT values were averaged across technical replicates and normalized against RPS17 ...
-
bioRxiv - Genetics 2022Quote: ... Sanger sequencing was performed directly on 1µL of PCR reaction in the presence of 5µM primer and the Big Dye Terminator V3.1 (Applied Biosystems™). The following thermocycler program was used ...
-
bioRxiv - Microbiology 2019Quote: ... The synthesized cDNA was mixed with specific primers for each segment in SYBR Green PCR Master Mix (Applied Biosystems) and the reaction performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Microbiology 2019Quote: ... qPCR reactions were performed in triplicate using specific primers and the Power SYBR Green PCR Master Mixture (Applied Biosystems) in a Viia7 Applied Biosystems Light-cycler ...
-
bioRxiv - Pathology 2019Quote: ... INF2 was then PCR amplified from cDNA using isoform-specific primers (Supplementary Figure 1) (Accuprime DNA Polymerase system, ThermoFisher). The PCR amplified product was gel-purified and examined for INF2-isoform-specific sequences using DNA sequencing (Genewiz).
-
bioRxiv - Genetics 2019Quote: ... DNA was PCR amplified for 12 cycles with Illumina primers PE1.0 and PE2.0 and Phusion DNA polymerase (1 unit, Thermo Scientific). Six PCR reactions were pooled for each library ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and 1.0 µl was used as a template for a second round of amplification with 1.0 µM of the same degenerate primers using the Platinum Hot Start PCR Master Mix (Invitrogen). Thermocycler conditions were 94°C for 5 min ...
-
bioRxiv - Immunology 2019Quote: ... qPCR was performed with primers against the Hh cdtB gene using a Viia7 Real-Time PCR system (Applied Biosystems) as described by Maloy et al. ...
-
bioRxiv - Neuroscience 2021Quote: Genotyping and CAG repeat sizing were performed by PCR of ear-biopsy DNA and all primers were from Invitrogen. For zQ175 mice ...
-
bioRxiv - Plant Biology 2022Quote: ... and specific DNA primers (SI Appendix, Table S4) in a StepOnePlus Real-Time PCR system (Applied Biosystems, CA, USA) using SYBR GreenER qPCR Super Mix (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... PCR reactions were performed using MEL_015 and MEL_016 specific primers and one unit of Phusion DNA Polymerase (Thermo Scientific) in a 50 μl final volume.
-
bioRxiv - Molecular Biology 2021Quote: ... Lysosomal ExRai AMPKAR was made by inserting PCR-amplified LAMP149 generated using primers 7-8 into HindIII (ThermoFisher FD0504)/BamHI-digested ExRai AMPKAR backbone ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Developmental Biology 2022Quote: ... and ret51 (ENSDART00000077627.7) splice variants were amplified from cDNA libraries using forward (GGCTCCTTTCGCTCGAATCA) and reverse (ACACTCAGCTTAATGTAGTTATTGTTGCAC) primers and Phusion PCR (Invitrogen). ret9 and ret51 splice variant amplicons were cloned into pCR-Blunt II-TOPO vector using manufactures instructions (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using flanking primers mentioned in Table S1 to screen candidate colonies using Dreamtaq Master Mix (ThermoFisher). PCR products were analyzed by agarose gel electrophoresis and Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2022Quote: A second-round PCR amplification with allele-specific primers was carried out using DreamTaq DNA Polymerase (Thermo Scientific, EP0702) PCR in a final volume of 20 μl as follows ...
-
bioRxiv - Physiology 2022Quote: ... The attB PCR primer were designed according to manufacturer’s protocol (Gateway cloning system, Thermo Fisher Scientific, Waltham MA, USA). Forward primer contains Shine-Dalgarno and Kozak consensus sequence for protein expression in both E.coli and mammalian cells ...
-
bioRxiv - Molecular Biology 2022Quote: ... p2×7 (Mm00440582_m1) and tgfβ (Mm01178820_m1) were determined by quantitative PCR using Taqman primers and probe (Applied Biosystems, USA) and Taqman Gene Expression Master Mix (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reverse transcription PCR was performed with the RevertAID First Strand cDNA synthesis kit and Oligo-dT primers (Thermo Scientific). DCAF15 RNA was quantified in a PCR reaction using SYBR select master mix (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Standards for viral copy number were created by cloning PCR product using custom BdDV-1 primers into the pCR 2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen). Transformed Escherichia coli colonies with successful insert were plasmid extracted using the Zyppy Plasmid Miniprep kit (Zymo Research) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.25 µM of specific primers and 10 µl of Fast SYBR™ Green PCR Master Mix (Applied Biosystems; #4385612) in a total volume of 20 µl ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Cell Biology 2023Quote: ... PCR with primers p4 (5’ ATTTCAGTGG GACCTCAATGCC) and p5 (5’ GTGA CAGTCCAGGTGGAAACAAA) and Bpu10I digestion (Thermo Fisher Scientific #FD1184) was used to confirm the genomic differences between the KO + hTRIM28 and the KO + hTRIM28(S473A ...
-
bioRxiv - Cancer Biology 2024Quote: DNA was PCR-amplified and barcoded with P5/P7 primers (Integrated DNA Technologies) using Taq-Gold DNA polymerase (Thermofisher) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... and forward/reverse primers from IDT Technology in the QuantStudio™ 5 Real-Time PCR System (Applied Biosystems; A28574). The cycle was run 40 times at 95°C denaturation for 30 sec ...