Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for PCR Plates since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed in triplicates using QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was performed in triplicate on a 7500 Fast RealTime PCR System (Applied Biosystems) using TaqMan primer/probes (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCR analysis was performed using the Power SYBR™ Green PCR Master Mix (Applied Biosystems) or the AzuraQuant™ Green Fast qPCR Mix HiRox (Azura Genomics) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using Power SYBR Green Master Mix (Applied Biosystems) on a QuantStudio 7 Flex Real-Time PCR system ...
-
bioRxiv - Microbiology 2023Quote: ... Purified PCR fragments were ligated in pCR® II Vector – Dual Promoter TA Cloning Kit (Invitrogen-Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: The PCR amplifications were performed on a GeneAmp PCR System 9700 (Applied Biosystems, Monza-Brianza, Italy). All PCRs were performed by using the Taq DNA polymerase recombinant (Invitrogen™ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative RT-PCR (qRT-PCR) assays were performed using Taqman probes (Applied Biosystems/Thermo Fisher Scientific): SERPINB3 (Hs00199468_m1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time PCR was carried out using an ABI 7500 Real-Time PCR System (Applied Biosystems). Reactions for each sample were performed in triplicate ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using TaqMan Gene Expression Assays (Thermo Fisher Scientific) on a Roche LightCycler 480 ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was conducted on the QuanStudioTM Real-Time PCR system (Applied Biosystems, Foster City, CA). The total volume of each reaction was set to 25 μl ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCR was performed using a StepOnePlus or QuantStudio 3 real-time PCR system (Applied Biosystems) with Amplitaq Gold polymerase (Applied Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... All qRT–PCR reactions were carried out using SYBR Green PCR Master Mix (Applied Biosystems, USA) on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... followed by PCR and insertion into Zero Blunt TOPO PCR Cloning Plasmid (Thermo Fisher Scientific, 450245) which were transfected and expanded per manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR reaction was carried out in QuantStudio 7 Flex Real-Time PCR System (Invitrogen Biosciences). All the primer sequences were published previously (Liddelow et al. ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was used for real-time PCR with Fast SYBR Green PCR Master Mix (Applied Biosystems). Real-time PCR was conducted on QuantStudio 3 (Applied Bioscience) ...
-
bioRxiv - Physiology 2023Quote: ... Real-time PCR analysis was performed with Power SYBR Green PCR Master Mix (4367659; Life Technologies) by a StepOne Plus system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were then purified using a PCR purification kit (Cat#: K069, Thermo Scientific, China). The PCR libraries were constructed using Ion Plus Fragment Library Kit 48 rxns (Thermo Scientific ...
-
bioRxiv - Plant Biology 2024Quote: ... qRT-PCR was performed on an ABI 7500 Fast PCR System (ThermoFisher Scientific, Waltham, MA, USA), using the 2X PowerUp SYBR green master mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... Triplicate PCR reactions (20 μL) using Phusion™ High-Fidelity PCR MasterMix (Thermo Fisher Scientific, USA) were pooled and the amplicons of ∼450 bp were purified from 1.5% agarose (MP Roche ...
-
bioRxiv - Microbiology 2023Quote: ... RRT-PCR reactions were ran using AgPath-ID One Step RT-PCR Reagents (ThermoFisher Scientific #4387391) on a LightCycler 480 (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative PCR assays were carried out in the 7500 Real Time PCR System from Applied Biosystems using SensiFAST SYBR Lo-ROX Kit (BioLine ...
-
bioRxiv - Microbiology 2023Quote: ... PCR fragments were purified using a PureLink Quick Gel Extraction and PCR Purification Combo Kit (Invitrogen). Purified PCR fragments were electroporated into the GS1783 strain of E ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative real-time PCR was performed using the 7900HT Fast Real-Time PCR System (Thermo fisher) with commercial TaqMan primers (Thermo fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR (qRT-PCR) was performed using the StepOnePlus Real-Time System (Applied Biosystems). Relative quantification values were calculated with the associated StepOnePlus software ...
-
bioRxiv - Bioengineering 2023Quote: ... Real time quantitative PCR was performed using Power SYBR Green PCR Master Mix (Applied Biosystems, 4368708) on the ABI QuantStudio 3 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: The qRT-PCRs were performed in triplicate using a ViiA7 Real-time PCR System (Applied Biosystems). Briefly ...
-
bioRxiv - Plant Biology 2024Quote: ... PCRs were carried out on a GeneAmp® PCR System 9700 thermocycler (Applied Biosystems, Warrington, UK).
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time quantitative PCR reactions were performed on a 7300 Real-time PCR system (Applied Biosystems) using the THUNDERBIRD SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... quantitative real-time PCR (qPCR) was conducted on a StepOnePlus Real-Time PCR System (Applied Biosystems) using the PowerUP SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR was performed using the Platinum Green Hot Start PCR 2X MasterMix (Invitrogen, Thermo Fisher scientific) with the following forward GCCTACGGACAGATCGGGATG and reverse GTTGCGGCGGAGGATGAGT ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR were performed using Power SYBR® Green PCR Master Mix (Thermo Fisher Scientific, 4367659). Targets were measured using QuantiStudioTM Real-Time PCR Software version 1.3 ...
-
bioRxiv - Microbiology 2024Quote: ... Standard and high-fidelity PCR were performed with 2X DreamTaq Green PCR Master Mix (Thermo Scientific) or Q5 High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Developmental Biology 2024Quote: ... qRT-PCR reactions were run on StepOne Plus Real-Time PCR System (Applied Biosystems, Waltham, MA). The probe sequences for mmu-miR-129-5p and U6 snRNA were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2024Quote: ... Quantitative PCR experiments were performed with the QuantStudio 12K Flex Real-Time PCR System (Life Technologies) using a TaqMan detection protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... qRT-PCR was performed in technical triplicates with the StepOnePlus Real-Time PCR System (Applied Biosystems) (Supplementary Table 7) ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR was performed using the Platinum Green Hot Start PCR 2X MasterMix (Invitrogen, Thermo Fisher scientific) with the following forward GCCTACGGACAGATCGGGATG and reverse GTTGCGGCGGAGGATGAGT ...
-
bioRxiv - Molecular Biology 2024Quote: ... Semi-quantitative reverse transcription PCR was done on a QuantStudioTM 5 Real-Time PCR (Thermofisher ScientificTM) with specific Taqman probes targeting the genes of interest using the TaqMan Fast Advanced Master Mix for qPCR (Applied Biosystems #4444963) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative PCR was performed with the ViiA 7 Real-Time PCR System (Applied Biosystems, Waltham, MA). Primers for real-time PCR were manufactured at the Keck Biotechnology Research Laboratory at Yale University (New Haven ...
-
bioRxiv - Plant Biology 2024Quote: ... Quantitative PCR (qPCR) was performed on a Quant Studio 3 Real-Time PCR system (Thermo Fisher) using the KAPA SYBR Fast qPCR kit (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2024Quote: ... CA1 PCR products were also subcloned (Zero Blunt™ TOPO™ PCR Cloning Kit, Thermo Fisher) and single clones were sequenced.
-
bioRxiv - Neuroscience 2024Quote: ... Quantitative real-time PCR was conducted using a QuantStudio 5 Real-Time PCR System (ThermoFisher Scientific). All samples were run in triplicate ...
-
bioRxiv - Biochemistry 2024Quote: ... The fusion PCR products were cloned into pJET1.2 using the CloneJET PCR Cloning Kit (Thermo Scientific). Before transformation the fusion products were amplified by PCR ...
-
bioRxiv - Bioengineering 2024Quote: ... Real-time PCR was performed using a Quantstudio 3 Real-Time PCR System (Thermo Fisher Scientific). Three independent experiments were performed ...
-
bioRxiv - Cell Biology 2024Quote: ... Real-time PCR was carried out using an ABI real-time PCR system (Life Technologies, USA) and SYBR Green Pro TaqHS premix qPCR kit III (Accurate Bio ...
-
bioRxiv - Microbiology 2024Quote: ... The amplified PCR fragment was cloned using pCR® 4 Blunt-TOPO (Invitrogen, Waltham, MA, USA). ERV-DC8 OI32 (cat ID ...
-
bioRxiv - Immunology 2024Quote: ... qRT-PCR was performed using SYBR® Green real-time PCR kit (Thermo Fisher Scientific, USA) in a 20 µl reaction volume on the 7500 Fast RT-PCR (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... The purified PCR products were then ligated into pCR®-Blunt II-TOPO® vector (Invitrogen) and transformed into E ...
-
bioRxiv - Biophysics 2022Quote: ... 30,000 cells were seeded into a 24-well plate (NuncMicroWell Plates with Nunclon; Thermo Fisher Scientific, Waltham, MA, USA). At day 0 the transfection was done ...
-
bioRxiv - Bioengineering 2021Quote: ... All experiments were performed in 384-well plates (Clear Flat-Bottom Immuno Nonsterile 384-Well Plates, MaxiSorp, Life Technologies) which were sealed (Empore Sealing Tape Pad ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissociated hippocampal or cortical neurons were plated at 17,000 cells/well (96-well plate) or 1,000,000 cells/well (6-well plate) in neuron media (Neurobasal medium (ThermoFisher 21103049) supplemented with B27 (ThermoFisher 17504044) ...