Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 10000+ citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Day 10 post plating (7 days after air lift) cells were fixed in 4% PFA and stained for tight junction protein ZO-1 (Thermo Fisher Cat# 61-7300). Randomized Z stack images were taken at 20x in 3 different places of each transwell for three transwells and imported into ImageJ ...
-
bioRxiv - Cancer Biology 2023Quote: ... Tris-Glycine 10-20% or Bis-Tris 4-12% SDS-PAGE gels were run at 4℃ and proteins were transferred onto nitrocellulose membranes using 15 Volts for 7 minutes via the iBlot-2 system (Thermo Fisher Scientific, Waltham, MA). The membrane was then blocked for 1 hour in LICOR Odyssey blocking buffer and incubated at 4℃ with the appropriate antibody overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Sample concentration and purity was determined with the NanoDrop One (ThermoFisher, Cat # ND-ONE-W).
-
bioRxiv - Cell Biology 2024Quote: ... The labeling efficiency was calculated using NanoDrop One Spectrophotometer (Thermo Fisher Scientific #ND-ONE-W). The average probe labeling efficiency was ∼90% ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... and RNAse A (10 μg/ml) for 2h at 50℃ in the presence of SYTOX Green (0.5 μM, Invitrogen). Flow cytometry was performed on a LSRII (BD ...
-
bioRxiv - Immunology 2019Quote: ... Hybridization was performed for 2h at 40°C using the following species-specific probes: (Mouse: Cd14 (ThermoFisher, #VB1-3028230), Cd3e (ThermoFisher ...
-
bioRxiv - Pathology 2023Quote: Fixed FDB fibers were blocked for 2h at room temperature in Superblock™ Blocking Buffer in PBS (Thermo Scientific) with 0.04% saponin ...
-
bioRxiv - Molecular Biology 2023Quote: ... Gels were run at 150 V for 2h in 1× NuPAGE Tris-Acetate SDS Running Buffer (Thermo Fisher Scientific). Protein was transferred onto a PVDF membrane (Merck ...
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated for 2h at RT with secondary antibody mix of Alexa Fluor 647 anti-rat (Invitrogen, A-21247) and Alexa Fluor 488 anti-mouse (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by incubation for 2h at RT with fluorophore conjugated antibodies goat anti-Rabbit (AlexaFluor, Invitrogen, #A11036, 1:1000) and anti-GST-Dylight 650 (Columbia Biosciences ...
-
bioRxiv - Biophysics 2024Quote: ... Cells were allowed at least 2h to settle onto the slips before being transfected using Lipofectamine 2000 (Life Technologies) as described in the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... B-27 supplement and B-27 supplement minus antioxidants were purchased from Life Technologies (Grand Island, NY). Cocaine hydrochloride ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.2% GibcoTM Amphotericin B (250 µg/mL of Amphotericin B and 205 µg/mL sodium deoxycholate, Gibco) and 0.25% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... 110 nm ultrathin cryosections were collected on 7×7 mm silicon wafers with fluorescent beads (PS-Speck, ThermoFisher). Light microscopy images were acquired with a widefield microscope ...
-
bioRxiv - Cell Biology 2020Quote: ... pGWB610 and pGWB633 (9) using LR Clonase II (Thermo Fisher Scientific) to generate pFLOE1p:FLOE1-GFP ...
-
bioRxiv - Developmental Biology 2019Quote: ... The cells were cultured for 9 days with DMEM (Thermo Fisher), 20% fetal bovine serum (Thermo fisher) ...
-
bioRxiv - Bioengineering 2020Quote: ... 9 mL of DMEM/F12 media supplemented with 20% FBS (GIBCO) was added and cells were centrifuged at 300 RCF for 3 m ...
-
bioRxiv - Neuroscience 2021Quote: ... and JC-9 Dye (Mitochondrial Membrane Potential Probe) (ThermoFisher Cat# D22421) were purchased from Invitrogen (Carlsbad ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 9) or citrate buffer (10 mM, pH 6, ThermoFisher Scientific) as required for each primary antibody ...
-
bioRxiv - Developmental Biology 2022Quote: ... 9 mL of DMEM/F12 medium supplemented with 20% FBS (GIBCO) was added for neutralization and TrypLE Express washing ...
-
bioRxiv - Cell Biology 2019Quote: ... Sf-9 cells were transfected with isolated bacmids using Cellfectin (ThermoFisher), and after 4 days ...
-
bioRxiv - Immunology 2021Quote: ... Heat-induced antigen retrieval (citrate buffer pH 6 or 9 – Thermofisher) was performed using the microwave ...
-
bioRxiv - Genomics 2020Quote: ... were transferred using 9 μl Lipofectamine RNAi MAX Reagent (Invitrogen, USA). The cell migration and invasion capacity of Harbi1 on HUVECs cells were determined by transwell insert chambers (Corning ...
-
bioRxiv - Microbiology 2021Quote: ... Parasites were grown In vitro in HMI-9 medium (Life technologies) [21] at 37°C 5% CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sequences were analyzed using Vector NTI Advance 9 software (Invitrogen) [26-27].
-
bioRxiv - Bioengineering 2022Quote: ... 9 mL of DMEM/F12 medium supplemented with 20% FBS (GIBCO) was added for neutralization and TrypLE Express washing ...
-
bioRxiv - Cancer Biology 2022Quote: ... CD7/APC (clone GP40 [Leu-9], Invitrogen, cat. 17-0079-42), Fixable Viability Stain 700 (BD Biosciences ...
-
Mycobacteria form viable cell wall-deficient cells that are undetectable by conventional diagnosticsbioRxiv - Microbiology 2022Quote: ... Nucleic acids were stained using 2 µM SYTO 9 (S34854, Invitrogen). The plasma membrane was labelled using SynapseRed C2M (SynapseRed ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 9×103 cells/well and cultured in DMEM (Gibco, 11965118) with 10% FBS (Gibco ...
-
bioRxiv - Physiology 2023Quote: ... cell nuclei were stained with 9 μM Hoechst 33342 (Invitrogen, H3570) for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were transfected at DIV 9-16 by Lipofectamine 2000 (Invitrogen) according to the manufacturer’s manual ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 100 μg mL−1 hygromycin (31282-04-9, ≥98%, Invitrogen). Cells were split 1:5 when confluency reached 70% and discarded after passage 10 ...
-
bioRxiv - Neuroscience 2023Quote: ... after which 9 ml Essential 8 medium (Thermo Fisher Scientific, A1517001) was added to the well for resuspension ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were incubated in Gibco ™ LHC-9 medium (Thermo Fisher) and kept incubated at 37 °C and 5% CO2 until they reached the desired confluence ...
-
bioRxiv - Cancer Biology 2023Quote: ... mounted with fluorescence mounting medium (9 ml of glycerol [Fisher Scientific cat#BP229-1] ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 9 % v/v Fetal Bovine Serum (FBS) (Gibco, #10270106), 2 mM L-Glutamine (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each plasmid was mixed with 9 μL of Lipofectamine2000 (Invitrogen, UA) and incubated for 20 minutes at room temperature before being transferred into the growth medium ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 9 hpi with the fluorometer Fluoroskan Ascent FL (Thermo Fisher). Each measure was compared with the values obtained at 0 hpi.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... plates were blocked for one hour at room temperature (RT) in 100 µl 5 % skimmed milk (Fluka; 70166)/1X DPBS (Gibco; 70011-044) % w/v solution ...
-
bioRxiv - Microbiology 2022Quote: ... fluorescence was checked for the next one hour (with a 5-minute interval between two readings) in Varioskan Flash multimode reader (Thermo Fisher Scientific) at 530 nm and 590 nm wavelength for excitation and emission respectively.
-
bioRxiv - Molecular Biology 2022Quote: ... One vial of frozen PHH (∼5 × 105 cells) was thawed in 50 mL of Cryopreserved Hepatocyte Recovery Medium (Gibco, Thermo Fisher Scientific). After nucleofection cells were seeded on collagen-coated 96-well cell culture plates (Corning ...
-
bioRxiv - Molecular Biology 2022Quote: ... One vial of frozen PHH (∼5 × 105 cells) was thawed in 50 mL of Cryopreserved Hepatocyte Recovery Medium (Gibco, Thermo Fisher Scientific). After nucleofection cells were seeded on collagen-coated 96-well cell culture plates (Corning ...
-
bioRxiv - Immunology 2024Quote: ... qPCR was performed on an Applied Biosystems Quantstudio 5 machine using the AgPath-ID One-Step RT-PCR kit (Applied Biosystems, 4387391) and Taqman primers as per manufacturer recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... incubated overnight at 4°C or at room temperature for 4 hrs in one of the following primary antibodies: 1:3000 mouse α-GFP (MA5-15256, Thermo Fisher Scientific), 1:3000 rabbit α-hexokinase (H2035-01 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Secondary antibodies were diluted in blocking solution and incubated with samples for at least one hour and not more than 4 hours as follows: Alexa 488 donkey α-mouse (1:1000, Thermo Fisher Scientific), Alexa 647 goat α-rabbit (1:1000 ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Neuroscience 2021Quote: ... preparations were washed six times with PBT and incubated for one night at 4°C with secondary antibodies goat anti-rabbit Alexa 488 (Invitrogen, USA; 1:250) and goat anti-mouse DyLight 649 (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...