Labshake search
Citations for Thermo Fisher :
2351 - 2400 of 7168 citations for 6 HYDROXY 7 METHYLPURINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... on a QuantStudio 6 Flex Real Time PCR system (Life Technologies) using forward and reverse primers (NOTCH3-F CGTGGCTTCTTTCTACTGTGC ...
-
bioRxiv - Physiology 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole) (D1306) was purchased from Invitrogen. XMU-MP1 (#22083 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Developmental Biology 2023Quote: ... Reactions were -treated using 6 U of Turbo DNase (ThermoFisher, UK) at 37°C for 15 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... anti-Integrin alfa-6 (ITGA6) (1:1000) (MA5-16884, ThermoFisher Scientific) for 1 h at room temperature ...
-
bioRxiv - Developmental Biology 2023Quote: ... or with Cultrex SCQ (Bio-techne) coated 6 well plates (Nunc). Cells were passaged as small clumps every 4 to 5 days with Dispase (Gibco) ...
-
bioRxiv - Genomics 2023Quote: ... with specific primers on a QuantStudio 6 Flex instrument (Applied Biosystems). mRNA expression was normalized to the housekeeping gene Ppib for all samples ...
-
bioRxiv - Immunology 2023Quote: ... qPCR analysis was conducted on a QuantStudio 6 (Thermo Scientific, USA) using TaqPath master mix (Thermo Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and 1.8% sodium chloride (Fisher Scientific, ACS Cas.# 7647-14-6). After 20 minutes undisturbed ...
-
bioRxiv - Molecular Biology 2023Quote: ... The amplified DNA was separated by using 6% TBE gels (Invitrogen) and imaged.
-
bioRxiv - Biophysics 2023Quote: ... using the QuantiStudio 6 Flex system (Applied Biosystems: Waltham, MA, USA). Gene expression was analyzed using the ΔΔCT method ...
-
bioRxiv - Genetics 2023Quote: ... along with 6 µL of PageRuler Plus Prestained Protein Ladder (ThermoFisher) as standard and electrophoresed at 170 V using the Mini Trans-Blot cell system (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... or 6 was then used to transform into stbl3 strain (Invitrogen) for further plasmid amplification.
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were loaded onto precast 6% TBE (Invitrogen, Fisher cat #EC62655BOX) or 10% TBE-Urea (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... for detection in QuantStudio 6 Pro cycler (Applied Biosystems Carlsbad, CA). Quantification of each transcript was normalized to the mouse 18S reference gene following the 2-ΔΔCt method ((Livak & Schmittgen ...
-
bioRxiv - Neuroscience 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2024Quote: ... were coated with IL-6 capture antibody (ThermoFisher Scientific, MP5-20F3) and left overnight at 4°C ...
-
bioRxiv - Genetics 2023Quote: ... and analysed using the Quant Studio 6 Flex system (Applied Biosystems). The real-time qPCR conditions were one hold at (95 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were grown for 6 passages in DMEM-HAM’s F12 (Gibco) supplemented with 5% (v/v ...
-
bioRxiv - Biochemistry 2024Quote: ... and 0.30 M di-benzo-18-crown-6-ether (Thermo Scientific) following published protocols66,67,79,80,110 ...
-
bioRxiv - Physiology 2024Quote: ... on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) with specific primers for each gene ...
-
bioRxiv - Neuroscience 2024Quote: ... or Quant Studio 6 Pro Real-Time PCR System (Applied Biosystems). TaqMan assay details are listed in Tab ...
-
bioRxiv - Cancer Biology 2024Quote: ... The desired DNA product was purified with 6% TBE gel (Invitrogen) and samples were sequenced on an Illumina HiSeq2000 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Genomic DNA was eluted 6 times in ultrapure water (Thermofisher, 10977) for maximum recovery ...
-
bioRxiv - Microbiology 2024Quote: ... Real-time qPCR was performed on QuantStudio 6 Pro (Applied Biosystems) using iTaq Universal SYBR Green Supermix (Biorad) ...
-
bioRxiv - Immunology 2024Quote: ... and real-time PCR system (Applied Biosystems 7500 QuantStudio 6 Pro). The Ct value of target genes obtained from each sample was normalized to housekeeping gene GAPDH and relative gene expression was quantified using 2-ΔΔct values.
-
bioRxiv - Microbiology 2024Quote: ... 6-5 cells were maintained in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% FetalPlex (Gemini Bio-Products) ...
-
bioRxiv - Immunology 2024Quote: ... and human IL-6 (Gibco, PeproTech, #200-06; 20 ng/mL). Prostaglandin E2 (PGE2 ...
-
bioRxiv - Genomics 2024Quote: ... a QuantStudio 6 Flex Real-Time PCR system (Applied Biosystems, USA), with a 20 µl reaction mixture ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstained with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) and mounted on to glass slides in FluorSave™(Millipore) ...
-
bioRxiv - Genetics 2024Quote: ... and the homozygote variant iPSCs were grown in a feeder-free manner on Matrigel (Corning)-coated 6-well plates in Essential 8 (E8) medium (ThermoFisher Scientific). Media was changed daily ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eluted in 6 μl nuclease-free water (Ambion, cat# AM9937).
-
bioRxiv - Microbiology 2020Quote: ... bacilliformis shifted to liquid medium at pH 7 using a 5’ RACE System kit (Invitrogen; Carlsbad, CA) according to manufacturer’s protocols and with gene-specific primers (S1 Table) ...
-
bioRxiv - Cell Biology 2020Quote: Total RNA was isolated from osteoclast cells at day 7 with the Trizol reagent (ThermoFisher, Waltham, MA) and RNeasy mini kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... excess Alexa Fluor 647 and biotin were removed using 7-kDa Zeba desalting columns (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Molecular Biology 2021Quote: ... Real-time PCRs were performed using the AB quantitative real-time PCR system ViiA 7 (Applied Biosystems). Fast SYBR Green master mix (Life ...
-
bioRxiv - Molecular Biology 2022Quote: ... Low ROX (Quanta bio) in a ViiA 7 Fast Real-Time PCR System (Applied Biosystems Waltham MS). Primers were as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-time PCR reactions were run on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Molecular Biology 2021Quote: ... The temperature was maintained at 37 °C by a thermostatic water circulator (NESLAB RTE-7; Thermo Scientific). The samples were prepared in 20mM HEPES ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then resuspended in 10 µM CellEvent Caspase 3/7 activity reporter in PBS (Invitrogen, #C10723) and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Plant Biology 2019Quote: ... qRT-PCR was performed using the Applied Biosystems ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) with a 5μl reaction mixture containing 2.5μl 2× SYBR Green MasterMix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... The TCEP was removed by desalting on a spin column (Zeba, 7 KDa MW cutoff, Thermo Scientific).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Relative quantitative PCR analyses were performed on the QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). SAMHD1 mRNA expression levels were quantified by using the ΔΔCt method with RNaseP mRNA as an endogenous reference control ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR was performed by using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Waltham, USA) and DyNAmo ColorFlash SYBR Green qPCR Kit (Thermo Fisher ...
-
bioRxiv - Bioengineering 2019Quote: ... cell nuclei in the actin-stained samples were labeled with propidium iodide (7 μM, Molecular probes; P3566). The stained samples were visualized with a confocal laser scanning microscope (Leica TCS SP5X with a 40×/1.1 HCX PL Apo CS lens) ...
-
bioRxiv - Immunology 2021Quote: ... AMs were collected at day 7 to detect TLR4 expression with PE-anti TLR4 antibody (UT41, Invitrogen) by flow cytometry ...
-
bioRxiv - Microbiology 2021Quote: ... mRNA was quantified by real-time PCR using a ViiA 7 Real-Time PCR System (Life Technologies), fast SYBR Green Master Mix (Applied Biosystems ...