Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for Nonanoic acid reaction products with diethanolamine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... qRT-PCR reactions were conducted in three replicates with a final reaction volume of 10 µL in MicroAmp Fast Optical 96 Well Reaction Plates (Thermo Fisher Scientific) containing 1X GoTaq qPCR Master Mix (Promega Corporation) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 μM of Alexa Fluor® 594 azide (A10270) in Click-iT reaction buffer according to manufacture protocol (Click-iT® reaction buffer kit C10269, Invitrogen). Embryos were washed twice for 10 minutes in PBS solution with 2% BSA ...
-
bioRxiv - Neuroscience 2022Quote: ... Reverse transcription reactions were diluted 1:5 in water and qPCR reactions were set up with Luminaris HiGreen qPCR Master Mix (Thermo Fisher Scientific) on a LightCycler® 96 (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... The 25 μL of polymerase chain reaction of each reaction included 12.5 μL of Master Mix AmpliTaq Gold™ 360 (Applied Biosystems, USA), 20 mM of each primer and 6 μL od DNAse/RNAse free water ...
-
bioRxiv - Cell Biology 2023Quote: ... incubated at 65°C for 5 min and then immediately chilled on ice for at least 2 min before adding 4 μL reverse transcription reaction mix [in 10 μL RT reaction: 1× First Strand buffer (Invitrogen – 18064- 014), 20 mM DTT (Invitrogen - 18064-014) ...
-
bioRxiv - Biochemistry 2023Quote: ... Then cells were fully permeabilized with 0.1% Triton X-100 for 5 min at room temperature and subsequently incubated with the click reaction buffer for 30 min according to the Click-iT Cell Reaction Buffer Kit (Thermo Fisher Scientific). After washing with 2% BSA in PBS solution ...
-
bioRxiv - Microbiology 2023Quote: ... Barcoding PCR reactions were set up as a single 50 μl reaction using the DreamTaq PCR Master Mix (Thermo Fisher Scientific, USA), with 0.8 μmoles of each used barcoding primer and 10 μL of purified and normalised first-step PCR product as template ...
-
Epigenetic deregulation of IFN and WNT pathways in AT2 cells impairs alveolar regeneration (in COPD)bioRxiv - Cell Biology 2023Quote: ... MicroAmp™ Optical 384-Well Reaction with 10µL reactions were loaded into a QuantStudio™ 5 Real-Time PCR System (Applied Biosystems) and run according to the following recommended program 10 min 55C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Quantitative PCR was performed on samples by assembling the individual reactions in MicroAmp Fast Optical 96-well Reaction Plates (Applied Biosystems, 4346906) as follows ...
-
bioRxiv - Pathology 2024Quote: ... A total of 10 μL of reaction mixture was loaded into each well of a MicroAmpTM Fast Optical 96-well qPCR reaction plate (Applied Biosystems, UK) and centrifuged at 1500 rpm for 1 minute ...
-
bioRxiv - Neuroscience 2024Quote: ... qPCR was performed using either TaqMan Universal PCR Master Mix for reaction based on dual-labelled probes or the SYBR Green PCR Master Mix for SYBR Green reactions (both from Thermo Fisher Scientific) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Trp53 1loxP genotyping PCR reaction was performed in a 20 μL reaction using AmpliTaq Gold 360 master mix (4398881; Thermo Fisher Scientific), 0.5 μM each primer (p53loxF AGCCTGCCTAGCTTCCTCAGG and p53loxR CTTGGAGACATAGCCACACTG ...
-
bioRxiv - Microbiology 2020Quote: PCR reactions were performed using Phusion polymerase (Thermo Fisher) according to the manufacturer’s manual ...
-
bioRxiv - Microbiology 2020Quote: ... RT reaction with SuperScript IV RT (Thermo Fisher Scientific) was performed per manufacture’s recommendations with 150 ng of random primers (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... A BP reaction using BP Clonase II (Invitrogen, USA) was performed to clone the insert into pDONR221 (Invitrogen) ...
-
bioRxiv - Immunology 2022Quote: ... Color reactions were developed with tetramethylbenzidine substrates (TMB, Invitrogen). Antibody levels are presented as optical density absorbance values at 450 nm (BioTek ELISA plate reader).
-
bioRxiv - Genomics 2022Quote: ... 2.5 μL 10x PCR reaction buffer (Invitrogen, Waltham, MA), 0.75 μL of mgCl2 (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... Capture reactions were transferred to microspin cups (Pierce, ThermoFisher), centrifuged at 2,000 g for 30 seconds ...
-
bioRxiv - Cell Biology 2020Quote: ... A Gateway reaction using LR Clonase II Plus (Invitrogen) generated the pTol2-ubi:mito-Keima,cryaa:Cerulean vector following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... TRAP reactions utlized Platinum Taq DNA Polymerase (Invitrogen 10966), and were resolved on 10% polyacrylamide 0.5x TBE gels ...
-
bioRxiv - Neuroscience 2021Quote: ... Reactions of 20µl in PowerUp SYBR green (Thermofisher, UK) were performed in triplicate for each case on a Stratagene MXP4000 system (Agilent Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A quantitative PCR reaction with 1 × SYBR Green (Invitrogen), custom-designed primers and 2 × NEB MasterMix (New England Labs ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were performed using a StepOnePlus System (Life Technologies). Relative expression was calculated using the ΔΔCT method ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were performed using a StepOnePlus System (Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... The reaction mixture contained 1X mTOR kinase buffer (Invitrogen), 1X protease inhibitor cocktail (Roche) ...
-
bioRxiv - Plant Biology 2021Quote: ... were generated by Gateway-cloning (LR reaction, Thermo Scientific) the TYLCV ORFs from pENTR/D-TOPO into pGWB2 (Nakagawa et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR reaction mix containing Pfu polymerase (Thermo Scientific) was subjected to PCR program ...
-
bioRxiv - Genetics 2021Quote: ... Reactions were purified using a PCR purification kit (Invitrogen) followed by digestion with DNA degradase plus (Zymo ...
-
bioRxiv - Microbiology 2021Quote: ... 5 mM DTT and SuperScriptTM IV Reaction Buffer (Invitrogen) for 10 minutes at 50-55°C ...
-
bioRxiv - Plant Biology 2021Quote: ... LR reactions (Gateway Cloning Technology, Life Technologies; Carlsbad, USA) were performed to introduce CDS’s into the estradiol-inducible destination vector pMDC7 with a C-terminal YFP-HA CDS (40) ...
-
bioRxiv - Microbiology 2020Quote: ... RNase reaction was stopped by adding Trizol LS (Invitrogen) to the sample.
-
bioRxiv - Cell Biology 2022Quote: Prepare RT reaction with SuperScript III (Thermo Fisher – 18080044). (all 12 μL of RA3 adapter-ligated sample ...
-
bioRxiv - Biochemistry 2022Quote: ... via an LR clonase II reaction (Invitrogen, Waltham, MA). VSV-G-pseudotyped lentivirus was generated by cotransfection of HEK-293T cells (CRL-3216 ...
-
bioRxiv - Immunology 2022Quote: ... A T7-driven in vitro transcription reaction (Megascript, Ambion) using linearized plasmid template was performed to generate mRNA with 101 nucleotide long poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reaction was performed using Phusion polymerase (Thermo Fisher), an annealing temperature of 63 °C ...
-
bioRxiv - Microbiology 2022Quote: ... Reactions were run on AgPath RT-PCR (Life Technologies) kit on a QuantStudio™ 7 Flex Real-Time PCR System and the relative amounts of FAM and HEX signal used to determine the proportion of Omicron and Delta in the original samples ...
-
bioRxiv - Genomics 2022Quote: ... were mixed in 1X TdT Reaction buffer (Thermo Scientific) and incubated overnight at 37 °C ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... Reactions were performed in a ProFlex thermocycler (Applied Biosystems) as follows ...
-
bioRxiv - Genomics 2021Quote: ... Reactions were loaded onto 6% DNA retardation gels (ThermoFisher) and run in 0.5X Tris–borate–EDTA buffer for 2 hours ...
-
bioRxiv - Developmental Biology 2021Quote: ... Reactions were carried out on a QuantStudio3 (Applied Biosystems) real time PCR machine using the following program ...
-
bioRxiv - Developmental Biology 2020Quote: ... the reaction was stopped by adding DMEM medium (Gibco) containing 10% FCS ...
-
bioRxiv - Plant Biology 2021Quote: ... In a multisite Gateway LR reaction (Thermo Fisher Scientific), both genes were transferred simultaneously into destination vector pBiFCt-2in1-NN (N-terminal nYFP and cYFP fusions (Grefen and Blatt ...
-
bioRxiv - Molecular Biology 2020Quote: ... Reactions were carried out using PCR MM (Thermo Scientific). RT-PCR was carried out under the following conditions ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions with TaqPath master mix (Thermo Fisher) were assembled following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... A reaction mixture was prepared containing 10 × Buffer (Invitrogen), 0.2 mmol/l each deoxyribonucleotide (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... the reaction was developed with ABTS substrate (Life Technologies).
-
bioRxiv - Cancer Biology 2020Quote: ... in MicroAmp Optical 96-well reaction plates (Applied Biosystems). The 2-ΔΔCT method was used to measure the gene expression compared with the endogenous controls (U6 non-coding small nuclear RNA for miR-147b and GAPDH for mRNAs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Reaction Buffer Kit (#C10269, Invitrogen, Thermo Fisher Scientific) for 30 min in the dark at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Reaction Buffer Kit (#C10269, Invitrogen, Thermo Fisher Scientific) for 30 min in the dark at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... A reaction mixture was prepared containing 10× Buffer (Invitrogen), 0.2mmol/l each deoxyribonucleotide (Invitrogen) ...