Labshake search
Citations for Thermo Fisher :
2251 - 2300 of 10000+ citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Plant Biology 2019Quote: Developing gemma cups located within 3 mm from an apical notch of 3-week-old thalli were manually dissected and immediately immersed in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA). For the control ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Molecular Biology 2022Quote: 3′-RACE was used to determine the length of the mRNA 3′UTRs using the 3′RACE System for Rapid Amplification of cDNA Ends kit (Thermo Fisher Scientific, Carlsbad, CA, USA). Yeast total RNA used for steady-state and half-life northern blots was used to generate cDNA using SuperScript™II RT (Thermo Fisher Scientific ...
-
Diurnal regulation of SOS Pathway and Sodium Excretion Underlying Salinity Tolerance of Vigna marinabioRxiv - Plant Biology 2024Quote: ... From the extracted RNA we prepared libraries for 3’mRNA-seq with Collibri 3’mRNA Library Preparation Kit for Illumina Systems (Thermo Fisher Scientific K.K., Tokyo, Japan). The prepared libraries were sequenced with Hiseq4000 as a customer service of GeneBay Inc ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse IgGs were stained with Alexa Fluor 568 conjugated donkey anti-mouse IgG (Invitrogen, Cat#A-10037). Panleucocytes were identified using rat anti-mouse CD45 antibodies (BD Pharmingen Inc ...
-
bioRxiv - Neuroscience 2021Quote: ... biotinylated horse anti-mouse IgG (H+L) and biotinylated goat anti-mouse IgG2a (Life Technologies, ThermoFisher Scientific).
-
bioRxiv - Neuroscience 2021Quote: ... biotinylated horse anti-mouse IgG (H+L) and biotinylated goat anti-mouse IgG2a (Life Technologies, ThermoFisher Scientific).
-
bioRxiv - Bioengineering 2022Quote: ... Mouse IgG2a Fc Tag (Acro Biosystems) incubation followed with APC Goat anti-mouse IgG2a Fc Antibody (Invitrogen) staining and RFP expression ...
-
bioRxiv - Molecular Biology 2020Quote: ... and mouse antibodies were coupled to Dynabeads coated with Pan Mouse IgG antibodies (Thermo Fisher Scientific, 11042). 50 μL of the appropriate Dynabeads pre-coupled with the indicated antibody were added to the chromatin sample and incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... goat anti-mouse Alexa Fluor 568 or goat anti-mouse Alexa Fluor 488 secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Mouse monoclonal antibodies were detected with a goat anti-mouse IgG HRP-linked antibody (62-6520; Invitrogen) diluted 1:10,000 (v/v) ...
-
bioRxiv - Immunology 2020Quote: ... Isotype control and mouse monoclonal antibody to mouse IFNβ (Clone: MAR1-5A3) were purchased from Thermo scientific. SP600125 and C-16 purchased from Calbiochem ...
-
bioRxiv - Microbiology 2022Quote: ... CA) or Alexa Fluor 488 anti-mouse antibody (for LP11 and mouse anti-myc; Invitrogen, Waltham, MA) at a 1:250 dilution in FACS medium ...
-
bioRxiv - Neuroscience 2024Quote: ... BV-2 cells were fixed and sequentially incubated with Mouse-on-Mouse IgG Blocking Solution (Invitrogen R37621) and Navenci blocking solution at 37°C for 60 min each in a pre-heated humidified chamber ...
-
bioRxiv - Cancer Biology 2023Quote: ... Mouse IL21 protein levels in BM supernatant were determined using an IL21 Mouse ELISA kit (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... Alexa Fluor 488 goat anti-mouse and anti-rabbit IgG (Invitrogen, Waltham, MA; catalog # A-11001 (mouse) and A-11008 (rabbit) ...
-
bioRxiv - Neuroscience 2023Quote: Mouse samples: total RNA from mouse blood samples was extracted using the RiboPure RNA Purification Kit (Invitrogen). Total RNA from brain regions was extracted ...
-
bioRxiv - Neuroscience 2024Quote: ... and 647 (1:500 for all; PIA32773-mouse; A21202-mouse; PIA32731TR-rabbit; PIA32794-rabbit; A21448-sheep, Invitrogen). The sections were examined using an AX-R Confocal Microscope coupled to a fully automated Ti2-E system (Nikon Instruments Inc ...
-
bioRxiv - Microbiology 2024Quote: ... and amastigotes were labeled with mouse anti-P8 and A488-conjugated goat anti-mouse secondary antibody (Invitrogen); samples were co-stained with DAPI ...
-
bioRxiv - Microbiology 2024Quote: ... and amastigotes were relabeled with mouse anti-P8 and A488-conjugated goat anti-mouse secondary antibody (Invitrogen); samples were co-stained with DAPI ...
-
bioRxiv - Developmental Biology 2020Quote: ... 65 μM BD D-luciferin-Potassium Salt (Fisher Scientific). Luciferase assay readouts were performed on a Promega GloMax Discover Microplate Reader.
-
bioRxiv - Genomics 2020Quote: ... DNA (sodium citrate vacutainer, Fisher Scientific catalog #BD-366415) and RNA (EDTA vacutainer ...
-
bioRxiv - Microbiology 2020Quote: ... we used Columbia blood agar (BD Diagnostics, Fisher Scientific)) with 5% difibrinated horse blood (Hemostat Labs ...
-
bioRxiv - Neuroscience 2019Quote: ... LY6A (1:250; BD Bioscience, 553333 or ThermoFisher, 701919), LY6C1 (1:250 ...
-
bioRxiv - Cell Biology 2020Quote: ... separated by a 0.4 μ membrane (BD Falcon, ThermoFisher). The inner wells contained 107 young MPB or CB with the same number of old MPBs in the outer wells ...
-
bioRxiv - Microbiology 2022Quote: ... fixed and permeabilized with BD Cytofix/Cytoperm (Fisher Scientific), stained with anti-IFITM2/3 and goat anti-mouse IgG Alexa Fluor 647 ...
-
bioRxiv - Microbiology 2022Quote: ... in Tryptic Soy Broth (BD Bacto, Thermo Fisher Scientific) and filter sterilized (0.22 μm)) ...
-
bioRxiv - Immunology 2023Quote: ... CD4 (SK3, BD, BUV469 / S3.5, Thermo Fisher, PE-Cy5.5), CD8 (SK1 ...
-
bioRxiv - Immunology 2021Quote: ... 20 and 38 dpv using BD Vacutainer™ SST™ II Advance Tubes and BD Vacutainer Heparin Blood Collection Tubes (both Fisher Scientific). Serum tubes were centrifuged at 880 × g for 10 min and the resulting serum was aliquoted and stored at −80 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 µL of Herpes solution and 2.5 mL of 100 mM CaCl2), staining with Annexin V PE (BD Pharmagen™, BD Biosciences, CA, US and 1 mM 7-Aminoactiomycin D (Thermo Fisher Scientific) and analysis by Flow Cytometry using a BD LSRFortessa X20.
-
bioRxiv - Developmental Biology 2023Quote: ... YPH erg2Δ::Trp1 yeast was grown on a specific medium composed of 6.7g/liter BD Difco™ Yeast Nitrogen Base without Amino Acids (ThermoFisher Scientific, #BD 291940), 5g/liter Bacto™ Casamino Acids (ThermoFisher Scientific ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Primary (anti-flag mouse 1:200, Cell Signalling) and secondary antibody (anti-mouse Alexa 488 1:500, Thermofisher) were diluted in blocking buffer solution and incubated overnight at 4°C or 1 hour at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... samples were incubated with secondary anti-mouse antibody conjugated to HRP (goat anti-mouse-HRP, 32430; ThermoFisher Scientific) at 1:20,000 in 5% milk/1xTBST for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... or with unconjugated 4.3.1.3 mouse MAb and secondary detection with goat anti-mouse Alexa-Fluor 647 (A-21235; Life Technologies). Immunofluorescence was used to boost GFP signal in TgBAC(lck:gfp)vcc6 specimens with a chicken anti-GFP primary (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: Total mouse tau ELISA measurements were carried out using a total mouse tau ELISA kit (Thermo Fisher Scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: Cells were obtained from mouse spinal cord and/or cultured mouse embryonic fibroblasts resuspended in Trizol (Thermo Fisher). RNA was extracted using miRNeasy Mini Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... mouse anti-human IgG3 (HP6050) or mouse anti-human IgM (clone HP6083) at 1/1000 (Thermo Fisher Scientific) for 1 hour at RT ...
-
bioRxiv - Genomics 2022Quote: ... anti-mouse 800 (only used in Figure 8E,F to detect mouse anti- FLAG) (1:5000, Invitrogen A32730). Anti-Sloth1 and Anti-Sloth2 antibodies (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and with LIN (anti-mouse TER119-FITC, Thermo Fisher, 11-5921-82; anti-mouse CD31-FITC, Thermo Fisher, 11-0311-85 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Total RNA was extracted from mouse skin tissue or mouse/human EpSCs using Trizol reagent (Invitrogen, Massachusetts, USA), and used as a template for cDNA synthesize using HiScript II reverse transcriptase (Vazyme Biotech ...
-
bioRxiv - Immunology 2024Quote: CLP was performed on WT and Plk3−/− mice following retro orbital injection (0.1μg/g mouse) of anti-mouse GPIX (Emfret) conjugated to AlexaFluor-750 (ThermoFisher) as previously described 21 ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-mouse IgG Alexa546-labeled monoclonal antibody goat anti-mouse IgG Alexa633-labeled monoclonal antibody (ThermoFisher Scientific); DAPI ...
-
bioRxiv - Immunology 2023Quote: ... The secondary antibody reactive to mouse IgG (anti-Mouse IgG (H+L)-AF647) was purchased from Thermo Fisher Scientific.
-
bioRxiv - Microbiology 2023Quote: ... mouse primary antibody was visualised with 1:1000 Donkey α Mouse Alexa Fluor™ Plus 647 (Invitrogen, A32787) or 1:1000 Donkey α Mouse Alexa Fluor™ Plus 555 (Invitrogen ...