Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 10000+ citations for Human Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... were diluted in 50 mM carbonate buffer to a concentration of 1 μg/ml and coated at 50 ng/well on 96-well ELISA plates (MaxiSorp Nunc, Thermo Fisher Scientific K.K., Japan) overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... Specifically, 1 μg/ml purified hACE2 protein (Kactus, ACE-HM501) was coated onto a 96-well ELISA plate (Thermo Fisher Scientific, 44-2404-21) at 4°C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... and the bound NTCP-Fab complexes were incubated with a secondary HRP-conjugated Pierce recombinant protein L (Thermofisher, 1:5000 dilution in ELISA buffer) for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and the bound Arr3_ýC•IP6–Fab7 complexes incubated with HRP-conjugated Pierce recombinant protein L (cat: 32420, Thermofisher, 1:5000 dilution in ELISA buffer) for 30 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μL of T4 ligase buffer and 1 μL of T4 PNK (10 U μL−1, ThermoFisher Scientific). The reaction is incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... as measured on protein level (BCA protein concentration determination kit; before digestion) was labeled with 10-plexing tandem mass tags (TMT-10; Thermo Scientific) following the manufactures instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... were rapidly mixed at 1:1 ratio with varying concentrations of Ca2+ produced by reciprocal dilutions of 10 mM EGTA and 10 mM CaEGTA by using the Calcium Calibration Buffer Kit (ThermoFisher Scientific). The slope of kobs was used to determine kon rate in the units of s−1 M−1 ...
-
bioRxiv - Cancer Biology 2021Quote: Puromycin (10 mg/mL) and blasticidin (10 mg/mL) were purchased from Fisher Scientific (Waltham, MA; Figure 1). Stock solutions (100 µg/mL ...
-
bioRxiv - Molecular Biology 2020Quote: ... in 10% horse serum/PBS for 1 h at room temperature and 10 min with Hoechst dye (Invitrogen) (1 μg/μL ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Odour dilutions (10-2 for butanol and 10-1 linalool) in mineral oil (Acros Organics, product code: 124020010) were chosen due to their overall similar strength of response in the cockroach antennal lobe (Paoli et al ...
-
bioRxiv - Biochemistry 2020Quote: ... were cultured and maintained at 37 °C in a humidified atmosphere of 5 % CO2 in air in Dulbecco’s Modified Eagle’s Medium (DMEM) + GlutMAXTM-1 containing 10 % Fetal calf serum (FCS) and 1% Penicillin-Streptomycin (10 000 U/ml) (Gibco Life Technologies, Grand Island, NY, USA). The RPE-1 cell line was cultured with 50 %DMEM/50% F10 Nutrient Medium supplemented with 10 % FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... was diluted to 1 mg/ml using 10 mм hydrochloric acid (SA56-1, Fisher Scientific), and then mixed 1:1 with 0.2 M sodium carbonate–bicarbonate buffer (24095 ...
-
bioRxiv - Systems Biology 2021Quote: ... 100 U ml-1 penicillin and 10 mg ml-1 streptomycin (Gibco, Thermo Fisher Scientific).
-
bioRxiv - Systems Biology 2021Quote: ... 100 U ml-1 penicillin and 10 mg ml-1 streptomycin (Gibco, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... and 10 ml of 1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Life Technologies). Sf9 insect cells (ATCC CRL-1711 ...
-
bioRxiv - Microbiology 2023Quote: ... DMEM mixed 1:1 with Ham’s F12 nutrient mix and supplemented with 10 % FBS (Gibco) and 4 mM L-glutamine was used for adherent CHO cell culture ...
-
bioRxiv - Microbiology 2023Quote: ... Virus samples at variable dilutions (1:10 to 1:40,000) were mixed with FluoSphere (Invitrogen) beads (170nm ...
-
bioRxiv - Developmental Biology 2023Quote: ... 594 and 647 (1:1000 dilution) and 10 ng ml-1 of DAPI (ThermoFisher Scientific). Finally ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...