Labshake search
Citations for Thermo Fisher :
2201 - 2250 of 7824 citations for HER4 Human HEK 293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... MERS-CoV S2-apex-less (MERS-CoV S2-only construct with residues 811–824 replaced with GGSGGS and residues 1042–1073 replaced with a flexible linker) were expressed in Freestyle 293-F cells (ThermoFisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... Cells grown to a density of 3 million cells per mL were transfected using the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific) and cultivated for 3-5 days ...
-
bioRxiv - Immunology 2020Quote: ... spike protein was expressed by transiently transfecting plasmid encoding the HexaPro spike variant2 containing substitutions S383C and D985C3 with a C-terminal TwinStrep tag into FreeStyle 293-F cells (Thermo Fisher) using polyethyleneimine ...
-
bioRxiv - Immunology 2020Quote: ... and 1 μg DNA per 1 mL cell culture medium at a cell density of 0.8 106 cells/mL in FreeStyle 293 medium (Thermo Fisher Scientific). After 7 days of culture at 37°C and 5% CO2 ...
-
bioRxiv - Immunology 2021Quote: RBD-Fc and RBD-6xHis proteins were produced by transient transfection of Expi293F high-density cells with ExpiFectamine 293 Lipid Cation Transfection Reagent (Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: HEK293T and Flp-In T-REx 293 cells were maintained in 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (Thermo Fisher, 41966029) supplemented with 10% Fetal Bovine Serum (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: Flp-In T-REx 293 cells were co-transfected with pcDNA5/FRT/TO and pOG44 plasmids using Lipofectamine2000 (Thermo Fisher, 11668019). 24h after transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the respective plasmids using the protocol provided with the FreeStyle 293 Expression System (Thermo Fisher Scientific, Cat. no. K9000-01). The isotypes contain human V regions from hybridomas that were established from a human HHKKLL Trianni mouse (Patent US 2013/0219535 A1) ...
-
bioRxiv - Immunology 2021Quote: ... Cells grown to a density of 3 million cells per mL were transfected using the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific) and cultivated for four days ...
-
bioRxiv - Microbiology 2022Quote: ... Expi293 cells were transfected with the expression plasmid hACE2-1-740aa-8xHis or hACE2-1-614aa-8xHis using ExpiFectamine 293 (ThermoFisher Scientific). Four days later ...
-
bioRxiv - Cell Biology 2022Quote: The trimeric S-protein and its mutants were produced by transient transfection of Expi293F high-density cells with the ExpiFectamine 293 (Thermo Fisher) lipid cationic transfection reagent according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: A construct encoding for CDC-20::3xFLAG under a CMV promoter was transfected into Freestyle 293-F cells (Thermo Fisher Scientific). 48 hours later ...
-
bioRxiv - Cell Biology 2022Quote: ... over the course of 10 days the FBS-supplemented DMEM was serially diluted with FreeStyle 293 Expression Medium (ThermoFisher Scientific, USA). Once growing in 100% FreeStyle Medium ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant antibodies were produced by cotransfecting paired heavy and light chain expression plasmids into Expi293F cells using ExpiFectamine 293 transfection reagents (ThermoFisher Scientific), purified from culture supernatants using the Protein A/Protein G GraviTrap kit (GE Healthcare) ...
-
bioRxiv - Microbiology 2022Quote: ... Cell surface display DNA constructs for the SARS-CoV-2 spike variants together with a plasmid expressing blue fluorescent protein (BFP) were transiently transfected into Expi293F cells using ExpiFectamine 293 reagent (ThermoFisher Scientific) per manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein transport inhibition in T-REx-293 cell culture was achieved by the application of 1 µl/ml BD GolgiPlug (Fisher Scientific), diluted in appropriate culture medium ...
-
bioRxiv - Immunology 2022Quote: ... Cells grown to a density of 3 million cells per mL were transfected using the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific) and cultivated for four days prior to supernatent harvest ...
-
bioRxiv - Molecular Biology 2022Quote: The stable cell line expressing HMGN5 (HMGN5-FlpIn) was created using the T-REx™-293 Flp-In system (Life Technologies) according to the manufacturer’s protocol ...
-
Phospho-KNL-1 recognition by a TPR domain targets the BUB-1–BUB-3 complex to C. elegans kinetochoresbioRxiv - Cell Biology 2024Quote: ... elegans BUB-1 TPR (1-189)::3xFLAG under a CMV promoter was transfected into Freestyle 293-F cells (Thermo Fisher Scientific). 48 hours later ...
-
bioRxiv - Biochemistry 2024Quote: ... Expi293F cells were grown to a density of 3 x 106 cells/mL and transfected using the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific) and expression carried out for 3 to 5 days post-transfection at 37°C with 8% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... A mixture of 15 μg of pcDNA3.4-V-gene-mIgG1 vector and 15 μg of pcDNA3.4-V-gene-kappa vector were transfected into Expi293 cells using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... a kind gift from Jason McLellan) was expressed by transiently transfecting transiently transfecting plasmid using FreeStyle 293-F cells (Thermo Fisher) using polyethyleneimine ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were diluted to 3 × 106 cells/mL in antibiotic-free Expi293 Expression Medium and transfected using an ExpiFectamine 293 Transfection Kit (Thermo Scientific). ExpiFectamine 293 Transfection Enhancers 1 and 2 were added 20 h post transfection and cultures were incubated for 5 days post-transfection ...
-
bioRxiv - Biophysics 2023Quote: ... 400 μg of calmodulin and myosin-5 expression vectors (at a 1:6 ratio) were mixed with 15 ml FreeStyle 293 media (Thermo Fisher) and 1.2 ml of PEI (Polysciences ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells grown to a density of 3 million cells per mL were transfected with the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific) and cultivated for four days at which point the supernatant was harvested ...
-
bioRxiv - Biochemistry 2023Quote: ... The generation of stable expression cell lines in WDR76 knockout background was similar to the stable transfection of Flp-In™-293 Cell Line described by manual (Invitrogen). All cell lines were maintained in DMEM medium with GlutaMAX ...
-
bioRxiv - Immunology 2023Quote: ... cells were grown to a density of 3 × 106 cells/mL and transfected using the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific). Three to 5 days post-transfection ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell surface display DNA constructs for the SARS-CoV-2 G614 or its mutants or S2 together with a plasmid expressing blue fluorescent protein (BFP) were transiently transfected into Expi293F cells using ExpiFectamine 293 reagent (ThermoFisher Scientific) per manufacturer’s instruction ...
-
bioRxiv - Immunology 2022Quote: ... All fusion proteins were expressed in Expi-293F cells in 250-280 ml culture using the ExpiFectamine 293 Transfection Kit (Life Technologies) according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2023Quote: ... and human embryonic kidney 293 cells (HEK293) were purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Fisher Scientific, #MT10013CV) with 10% FBS at 37 °C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: The Flp-In cell line expressing GFP-CENP-E2055-2608 was generated using HeLa T-REx Flp-In 293 cells according to the Flp-In system protocol (Thermo Fisher). GFP-CENP-E2055-2608 was cloned into pcDNA5 FRT/TO vector ...
-
bioRxiv - Microbiology 2023Quote: ... All plasmids used in this study were generated by ATUM Bio and transient transfection was carried out following the manufacturer’s protocol for the ExpiFectamineTM 293 transfection kit (Thermo Fisher Scientific). Four days after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... including Camuiα were transfected into HEK293S GnTI-cells (2 x 106 cells per well in 6-well plates) cultured in FreeStyle 293 (Thermo Fisher), using the TransIT2020 transfection reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmids were co-transfected into Expi293F cells at a 2:1 (HC:LC) mass ratio using ExpiFectamine 293 Reagent (Thermo Fisher Scientific). At 7 days post-transfection ...
-
bioRxiv - Immunology 2023Quote: ... The plasmids were transiently co-transfected into Expi293F cells at a mass ratio of 2:1 (HC:LC) using ExpiFectamine 293 Reagent (Thermo Fisher Scientific). After transfection ...
-
bioRxiv - Microbiology 2024Quote: ... HIV-1 Env and ELC07 Fab used for cryo-EM were produced by transient transfection of Expi293 cells with endotoxin-free preparations of recombinant plasmids using ExpiFectamine 293 (Fisher Scientific). To produce ELC07 Fab ...
-
bioRxiv - Microbiology 2024Quote: HEK293S GnTI-(ATCC CRL-3022) suspension cells used for expression of HIV Env proteins were maintained in FreeStyle 293 expression medium (Life Technologies), supplemented with 1% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2024Quote: ... were acquired directly from Thermo Fisher Scientific as an authenticated product maintained according to the manufacturer’s guidelines in either FreeStyle 293 Expression medium (Cat #12-338-018, Thermo Fisher Scientific) or HyClone CDM4HEK293 media (Cat # SH30859 ...
-
bioRxiv - Microbiology 2024Quote: ... Expi293F cells were grown to a density of 3 × 106 cells/mL and transfected using the ExpiFectamine 293 Transfection Kit (ThermoFisher Scientific) and expression was carried out for 4 days post-transfection at 37°C with 8% CO2 ...
-
bioRxiv - Biochemistry 2024Quote: ... The plasmids were co-transfected into Expi293F cells at a 2:1 (HC:LC) mass ratio using ExpiFectamine 293 Reagent (Thermo Fisher Scientific) following the manufacturer’s protocol for a 25 mL culture ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were co-transfected at a 1:2 heavy to light chain ratio into Expi293F cells using the Expifectamine 293 Expression Kit (Thermo Fisher), and antibodies were purified with protein A agarose (Invitrogen) ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...