Labshake search
Citations for Thermo Fisher :
2151 - 2200 of 10000+ citations for Human integrin alpha 5 beta 3 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... V5 was detected with a mouse anti-V5 tag monoclonal antibody (Invitrogen), MOSPD2 was detected with a rabbit polyclonal antibody (Millipore Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... The monoclonal HA-epitope tag antibody 2-2.2.14 (Invitrogen, catalog no. 26183) was used for detection of hemagglutinin-tagged proteins (1:5000 dilution) ...
-
bioRxiv - Microbiology 2023Quote: ... Supernatants were incubated with CaptureSelect™ C-tag affinity resin (Thermo Fisher) at 4 °C for 45 mins ...
-
bioRxiv - Genetics 2023Quote: ... Samples were labeled with 10-plex tandem mass tag reagents (ThermoFisher Scientific) and separated into 60 fractions using high-pressure liquid chromatography ...
-
bioRxiv - Cell Biology 2023Quote: ... commercial protocol) and a fluorescent tag (Alexa Fluor® succinimidyl esters, Invitrogen™ ...
-
bioRxiv - Systems Biology 2024Quote: ... Peptides were labeled with 11-plex tandem mass tag (TMT, Fisher Scientific) reagents following the vendors instructions ...
-
bioRxiv - Immunology 2024Quote: ... and purified via CaptureSelect™ C-tag affinity matrix (Thermo Fisher Scientific). A further SEC polishing step was performed on a HiLoad 16/600 Superdex 200 pg column (GE Healthcare ...
-
bioRxiv - Biochemistry 2024Quote: ... then reacted with ∼65 µg of isobaric tandem mass tag (TMTpro; ThermoFisher) multiplexing reagents (final reaction volume 20 µL ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs05441121_cn (human) (ThermoFisher). This line has been submitted to the European Mouse Mutant Archive (EMMA ...
-
bioRxiv - Neuroscience 2021Quote: ... Hs06560655 (human) (ThermoFisher).
-
bioRxiv - Cell Biology 2024Quote: ... Human fibronectin (Invitrogen) was added to stamps at a concentration of 40 µg/ml for 1 hour ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 10% FBS (0.01 M HEPES, 1x sodium pyruvate, 0.05 mM 2-beta-mercaptoethanol (Gibco) and 0.1 mg/ml Penicillin-streptomycin (Sigma ...
-
bioRxiv - Microbiology 2021Quote: The IFN-β levels in BALF were determined using mouse IFN beta ProQuantum Immunoassay kit (ThermoFisher). IFN-α and IFN-β levels in the supernatants of cultured BMDCs were determined by ELISA (PBL Biomedical Laboratories).
-
bioRxiv - Developmental Biology 2022Quote: ... ELISA was performed using the ultrasensitive Amyloid beta ELISA kit from Invitrogen (Paina et al.,2011KHB3544) per manufacturer’s instructions with media samples diluted 1:2 in standard diluent buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... Levels of secreted amyloid-beta 1-42 were quantified using a sandwich ELISA kit (Invitrogen, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... ULBP6 (Hs04194671_s1) and beta actin (Hs99999903_m1) with TaqMan MGB probes all conjugated with fluorochrome FAM (Thermofisher). The cycling conditions were 50°C for 2 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Beta-Mercaptoethanol Thermo Fisher Scientific 21985023) with a SMAD inhibitor (SB-431542 Fisher Scientific 16-141) and WNT activator (CHIR-99021 Fisher Scientific S12632) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then incubated with 3X cholesterol or 5mM methyl beta cyclodextrin (MßC) (#377110050, Thermo Fisher) (doses chosen for biological effectiveness but minimal cellular toxicity [Supplementary Figures 2 and 3] ...
-
bioRxiv - Immunology 2019Quote: ... MRC5 human fibroblast cell line and A375 human melanoma cell line are cultured at 37°C under 5% CO2 in DMEM medium (Life Technologies) containing 1% glutamine ...
-
bioRxiv - Cell Biology 2021Quote: ... Transferrin, Selenite) premix (resulting in 10 µg/mL insulin, 5 µg/mL human transferrin and 30 nM sodium selenite) (Life Technologies). One droplet (10 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... HEMs were cultured in Medium 254 supplemented with 1% human melanocyte growth supplement (S-016-5, Cascade Biologics/Thermo Fisher Scientific) and 100 units/mL penicillin/streptomycin ...
-
bioRxiv - Immunology 2022Quote: ... and human lung fibroblast (MRC-5 cells, ATCC® CCL-171™) were cultured in Minimum Essential Media (MEM, Life Technologies) supplemented with 4% FBS and 2 mM L-glutamine at 37°C in an atmosphere of 5% CO2.
-
bioRxiv - Microbiology 2020Quote: ... Human nasal fluid samples were sonicated on ice (5 seconds at amplitude of 8 um; Fisher Scientific Model 705 Sonic Dismembrator) to create homogenous samples ...
-
bioRxiv - Microbiology 2020Quote: ... human epithelial cell line were cultured at 37°C with 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen, Waltham, MA) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 ng/ml human recombinant epidermal growth factor (EGF) and 50 µg/ml bovine pituitary extract (BPE)(all Thermo Fisher). Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2024Quote: ... Human TS cells were cultured in six-well plates precoated with 5 μg/mL of CorningTM collagen IV (CB40233, Thermo Fisher) and Basal Human TS Cell Medium [Dulbecco’s Modified Eagle Medium/F12 (DMEM/F12 ...
-
bioRxiv - Immunology 2023Quote: ... purified CD4+CD25+CD127lo naive Treg cells (5 × 104) were stimulated with Dynabeads Human T-activator CD3/CD28 (12.5 μl/ml) (Thermo Fisher Scientific) and IL-2 (100 U/ml ...
-
Pathogenic CD8 T cell responses are driven by neutrophil-mediated hypoxia in cutaneous leishmaniasisbioRxiv - Immunology 2023Quote: ... 20 U/mL recombinant human IL-2 at 37°C and 5% CO2 for 24 hours in RPMI 1640 (Gibco, Canada) containing 100 Units of penicillin and 0.1 mg/mL of Streptomycin (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... and VIC labelled human β actin endogenous control probe (Human - 4326315E) or RNA28S5 (Human - Hs03654441_s1) (Thermo Fisher Scientific) so that amplified mRNA can be normalised to β actin or RNA28S5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sections were blocked with 3% bovine serum albumin (BSA, Fisher Bioreagents) and 5% normal goat serum (NGS, Gibco #PCN5000) in PBS for 1 hour at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... A Lsm12-KO cell line of HEK293 cells was generated with Synthego’s chemically modified sgRNA 5’-CCAGAAUGUCCCUCUUCCAG-3’ and GeneArt Platinium Cas9 nuclease (ThermoFisher Scientific) that were transfected together into cells using Lipofectamine CRISPRMAX Cas9 transfection reagent (ThermoFisher Scientific).
-
bioRxiv - Genetics 2021Quote: The SNP STARRseq library (100ug plasmid DNA/replica) was transfected into LNCaP cells (5 × 107 cells/replica; 3 biological replicas) using the Neon Transfection System (Invitrogen). Cells were grown in RPMI 1640 medium supplemented with 10% FBS and collected 48hrs post-electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Neuroscience 2022Quote: ... Recordings were made with patch pipettes (3-5 MΩ) containing aCSF and 10 µM alexa-594 (Thermofisher, Waltham, MA, USA) and CSFcNs were targeted under visual guidance using their fluorescence ...
-
bioRxiv - Neuroscience 2021Quote: ... We washed the cells 3 times for 5 minutes each with 1X PBS and mounted with ProLong Gold Antifade Mountant with DAPI media (Invitrogen) to preserve the cells for imaging ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in Milli-Q water for 3 × 5 minutes and cover slipped with ProLong Gold Antifade (Invitrogen, P36930).
-
bioRxiv - Neuroscience 2021Quote: ... Tet-on 3’ UTR HP and 5’ UTR HP DG NSCs were brought in suspension by incubating with 0.25% trypsin (Gibco #15090) in Versene (Gibco #15040 ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was isolated from Hela cells (n = 3) subjected to EBSS-induced autophagy and treatment with 5 μM UNC0638 for 12 hours using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Soluble material was incubated with 3-5 μg of antibody bound to 50 μl protein A or protein G Dynabeads (Invitrogen) and incubated overnight at 4 °C ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Microbiology 2019Quote: ... was carried out by taking 500 µl of the culture from respective time points into Eppendorf tubes and incubated them with 5 µM 3’-(p-hydroxyphenyl fluorescein (HPF; Invitrogen) (0.5 µl of HPF from 5 mM stock ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3-9) or 5 µl (IP: Figure 2A-2C and input: Figure 2-9) RNAse A/T1 (Thermo Scientific #EN0551) and incubation the beads at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were washed 3 times with PBS (5 min, RT) and mounted using ProLong® Gold antifade mountant (ThermoFisher, P36930). STED microscopy was performed using a 100× objective on the STEDYCON 2-colour STED imaging system (Abberior Instruments) ...
-
bioRxiv - Neuroscience 2019Quote: ... A sequence including the zinc finger binding sequence (5’-GTCATCCTCATC-3’) (Gross et al., 2013; Perez et al., 2008) upstream of the hsyn1 promoter was synthesized (ThermoFisher) and inserted using the MluI and EcoRI restriction sites to generate pAAV-ZFBS-syn-PSD95.FingR-dNES-CaMPARI2_F391W_L398V-CCR5TC ...
-
bioRxiv - Cancer Biology 2019Quote: ... ssDNA (M13 primer ssDNA-M13 primer 5’-TGT-AAA-ACG-ACG-GCC-AGT-3’, paraformaldehyde (PFA) were purchased from ThermoFisher. PicoGreen variants were synthesized in house at ThermoFisher ...
-
bioRxiv - Microbiology 2021Quote: Approximately 200 ng of extracted vRNA was reverse transcribed using a universal 3′ primer (5′-AGGGCTCTTCGGCCAGCRAAAGCAGG) and Superscript III reverse transcriptase (RT) (Invitrogen). The RT product was diluted approximately 10,000-fold and used as a template for quantitative PCR (qPCR) ...
-
bioRxiv - Bioengineering 2020Quote: ... Separation was performed on an Aquasil C18 column (250 cm x 3 mm, 5 µm particle size; Thermo Fisher Scinetific) at a flow rate of 1 ml/min ...
-
bioRxiv - Immunology 2020Quote: ... was added using the primers 5’ GACCGTCTCGAGAAAAGAAAAGTCTTTGGACGATGTGAGC and 3’ GTGACTGAATTCTTACTAATGGTGATGGTGGTGATGGCCGCTCAGCCGGCAGCCTCTGA TCCAC and the product was subsequently cloned into the vector pPIC9K (Invitrogen) between the Xho I and EcoR I sites by doing a three-way ligation (EcoR I ...