Labshake search
Citations for Thermo Fisher :
2101 - 2150 of 6549 citations for 6 Chloro N methoxy N methyl nicotinamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... IL-6 (Thermo Fisher Scientific, #P620), P16 (SCBT ...
-
bioRxiv - Cell Biology 2024Quote: ... 6) glucose-free DMEM (Gibco, 11966025) for 24 hr ...
-
bioRxiv - Immunology 2024Quote: ... in 6-well plates (Thermo Scientific) at 1.5x106 cells per well for 1 h at 37°C in warm RPMI-1640 medium (GIBCO) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM magnesium chloride (Invitrogen) was added ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM magnesium chloride (Invitrogen) was assembled ...
-
bioRxiv - Neuroscience 2021Quote: ... while levels of IL-6 in supernatants were determined using IL-6 mouse ELISA kit (Thermo Scientific). Similarly ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 6 ml liquid MSgg medium of each well of a 6-well microplate (Thermo Scientific), and then grown for additional four days ...
-
bioRxiv - Microbiology 2020Quote: ... 6 × 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Genomics 2022Quote: ... Bisulfite-PCR was conducted using primer sets (Integrated DNA Technologies; Table 1) designed against specific genomic regions with Methyl Primer Express v1.0 software (Thermofisher Scientific). PCR amplicons were cleaned with AmpureXP beads (#A63882 ...
-
bioRxiv - Neuroscience 2019Quote: ... were designed based on the appropriate National Center for Biotechnology Information (NCBI) reference genome using the Methyl Primer Express v1.0 software (Thermofisher Scientific) to amplify 250-350 bp regions of interest upstream or downstream the transcription start site (TSS ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 7.4) containing 2 mM glucose for 2 hr with 100 nM of tetramethylrhodamine methyl ester (TMRM; Invitrogen, CA, USA). After the incubation ...
-
bioRxiv - Biophysics 2019Quote: ... N-((2-(iodoacetoxy)ethyl)-N-Methyl)- amino-7-Nitrobenz-2-Oxa-1,3-Diazole (IANBD ester) and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley ...
-
bioRxiv - Microbiology 2019Quote: QSG-MSP was performed to quantify the levels of CpG DNA methylation of CD4 and RUNX3.Primers for QSG-MSP were designed using Methyl Primer Express Software v1.0 (Applied Biosystems). Primer sequences for CD4 ...
-
bioRxiv - Biochemistry 2021Quote: The KDELR/Legobody complex at 0.8mg/ml was PEGylated by incubation with MS(PEG)12 methyl-PEG-NHS-ester (Thermo Fisher) at a 1:40 molar ratio for 2 hrs on ice to reduce preferred particle orientation on the grids ...
-
bioRxiv - Biochemistry 2022Quote: Changes in the mitochondrial membrane potential were determined as the changes in tetramethylrhodamine methyl ester (TMRM, T668, Thermo Fisher Scientific) fluorescence according to the manufacturer’s instructions with few modifications ...
-
bioRxiv - Microbiology 2023Quote: ... aeruginosa growth support by pyochelin and pyochelin methyl ester were performed in M9 minimal medium supplemented with 500 µM 2,2’-Bipyridine (Fisher Scientific). M9 minimal medium was prepared as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was then pegylated for 15 minutes with 2 mM MS(PEG)4 Methyl-PEG-NHS-Ester (ThermoFisher Scientific) before grids.
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were cultured for 24 hours in culture medium supplemented with 0.5% (w/v) methyl cellulose and B-27 (1/50, Life technologies).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Jurkat cells and NALM-6 expressing firefly luciferase- GFP (NALM-6) were cultured in RPMI 1640 (Thermo Fisher) supplemented with 10% FBS and 100 units/mL penicillin and streptomycin ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Genomics 2020Quote: ... on the QuantStudio 6 Flex (Life Technologies). Next ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). Samples were analyzed using a two-step amplification and melt curves were obtained after 40 cycles ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). The Ct values were analyzed by the enrichment compared to input method.
-
bioRxiv - Bioengineering 2019Quote: ... Novex TBE - DNA retardation gels (6%) – (ThermoFisher) were used for the electrophoresis.
-
bioRxiv - Neuroscience 2019Quote: ... in 6-well culture plates (ThermoFisher Scientific) with 800 µL of sterile medium added below the insert (Stoppini et al. ...
-
bioRxiv - Microbiology 2019Quote: ... 6’-diamidino-2 phenylindole (DAPI) (Life Technologies), and visualized on a Nikon TiE fluorescent microscope using 60X oil immersion objective ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Neuroscience 2020Quote: ... with 6 μl of RNaseout (Life Technologies). The lysates were sequentially treated with 12.6 μl of RNase-free DNase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Neuroscience 2019Quote: ... on a QuantStudio 6 (ThermoFisher, Waltham, MA) real-time PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... in a QuantStudio 6 thermocycler (Applied Biosystems) or in a StepOne Plus thermocycler (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 6 ug/mL Puromycin (Gibco #A1113803).