Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 10000+ citations for Recombinant Mouse Map2k1 His & GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Protein expression was confirmed by western blot using a 6x His-Tag HRP conjugated Monoclonal Antibody (Thermo Fisher Scientific). Once verified ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Systems Biology 2022Quote: HeLa cells and FUCCI -HeLa cells were cultured in DMEM medium (Hi Media, AT007) supplemented with 10% FBS (Gibco) and 1% Penicillin-Streptomycin (Hi Media, ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate including his-FAP-interacting peptides were collected and submit to a MS facility (Thermo Fisher, Inc.; USA) for analysis ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA4-V5-NAA80-M23L was constructed by subcloning NAA80 from pcDNA3.1-NAA80-V525 into the TOPO TA vector pcDNA 4/Xpress-His (Invitrogen). Then the M23L mutation was introduced and the N-terminal Xpress tag was replaced with a V5 tag ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 228-10481) cDNA was cloned into the BamHI-NotI of the pcDNA3.1(+)-myc-His expression vector (Invitrogen, CAT# V80020) yielding pcDNA3.1-BRCA2T (BRCA2/2662T) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The first round PCR reaction was performed by adding 1 µl of cDNA template to a 20 µl reaction containing 0.005 U of Platinum Taq Hi-Fidelity polymerase (Invitrogen) as previously described (59) ...
-
bioRxiv - Microbiology 2020Quote: ... An aliquot of 50 ng of purified HIV-1 env DNA was used to clone into the pcDNA 3.1D/V5-His-TOPO vector (Invitrogen) and MAX Efficiency Stlb2 competent cells (Life Technology ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Microbiology 2019Quote: Bacterially expressed ZIKV EDIII proteins (C-terminal 6 × His-tag) were conjugated to Ni-NTA Magnetic beads (Thermo Scientific) following manufacturers protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific) and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... hLIGHT (L83-V240) and mHVEM (Q39-T142) were separately cloned into the pMT/BiP/V5-His A vector (Invitrogen) and co-transfected into Drosophila S2 cells with the pCoBlast (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... FACS-sorted cells were suspended at 0.5×106 cells/mL in RPMI 1640 medium supplemented with 10% HI-FCS and 1% PenStrep (10378016; Gibco). CD14+HLA-DRneg/low/CD14+HLA-DRhigh monocytes were cultured in 96 well plates (200μL/well ...
-
bioRxiv - Immunology 2021Quote: ... Clonal amplification of the libraries was done using the Ion-PI-Hi-Q Sequencing 200 Kit (Thermo Scientific, USA) PCR emulsions ...
-
bioRxiv - Neuroscience 2023Quote: The plasmid for heterologous expression of fshr-1 in HEK cells was obtained by directionally cloning the fshr-1 cDNA into the pcDNA3.1/V5-His-TOPO vector (Invitrogen). The cDNA sequence of the fshr-1a gene isoform was amplified by PCR using cDNA from mix-staged wild-type C ...
-
bioRxiv - Plant Biology 2023Quote: ... and proteins were visualized using Ponceau stain as well as Western blot with monoclonal anti-His (Invitrogen MA1-21315), and polyclonal anti-GST (Thermo Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... and utilized Alt-R CRISPR-Cas9 crRNA/trRNA/Hi-Fi Cas9 ribonucleotide-protein complex (IDT) and Neon electroporation (ThermoFisher) to deliver the complex to the iPSC ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
bioRxiv - Immunology 2023Quote: ... Proteins containing a His-tag were purified by affinity chromatography using HisPur Ni-NTA resin (Thermo scientific, Cat#88222). Proteins were then eluted with 250 mM imidazole in 50 mM Tris-HCl and 300 mM NaCl ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Sequencing was done using the Ion PI™ Hi-Q™ Sequencing 200 Kit (Thermo Fisher Scientific, Catalog # A26772) on Ion Proton sequencer with sequencing data processing using the Torrent Suite TM Software (Ver ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... mCherry-Emp-V5His construct was cloned using Hifi DNA assembly kit (NEB E5520S into the pAc5.1/V5-His A vector (Invitrogen) using the following enzymes Acc65I and XhoI ...
-
bioRxiv - Immunology 2023Quote: HCMV US18 and US20 were amplified from the HCMV TB40/E BAC (accession #EF999921) and subcloned into pcDNA3.1-V5/His (Invitrogen) via the KpnI/NotI sites to generate pcDNA3.1 US18-V5/His and pcDNA3.1 US20-V5/His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ceSMSγ and ceSMSr cDNAs were PCR amplified and ligated into the copper-inducible pMT/V5-His B vector (Invitrogen).
-
bioRxiv - Genetics 2023Quote: ... standard fragment analysis conditions) with 0.8 ul PCR product is loaded in 9.4 ul Hi-Di Formamide (Applied Biosystems), with 0.1 ul GeneScan 500 LIZ (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... and gB[H527P]-His EVs was performed at 300 keV on a Titan Krios electron microscope (Thermo Fisher scientific) equipped with a Gatan K3 (5 μm/pixel ...
-
bioRxiv - Microbiology 2023Quote: ... we initially digested the pNL4-3 plasmid with EcoRI and XhoI and subcloned this fragment into pcDNA3.1/myc-His A (Invitrogen). To generate pcDNA3.1 NL4-3 Env TMTR ...
-
bioRxiv - Immunology 2023Quote: ... Amplification and cloning of the truncated versions of TGM4 (D1-3 and D4-5) was performed by PCR amplification using proofreading Taq polymerase Phusion Hi as per the manufacturer’s instructions (Invitrogen), full-length codon-optimised TGM4 as template ...
-
bioRxiv - Genetics 2024Quote: ... and 15 µL of each eluate was mixed with the same volume of Hi-Di formamide (Thermo Fisher Scientific). Samples were finally sequenced either in one or in both directions on a 3500 Genetic Analyzer device (Applied Biosystems/Hitachi ...
-
bioRxiv - Biophysics 2024Quote: ... The cDNA was eluted from Dynabeads using 11 μL Formamide-ROX mix (1000 μl Hi-Di Formamide (Thermo Fisher), 8 μl of 350 ROX size standard (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant AtGNL-6XHIS was detected using an anti-HIS (C-term)/AP antibody at a 1:2,000 v/v dilution (Invitrogen) and CDP-start ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Microbiology 2020Quote: ... All PCR reactions were carried out using Recombinant Taq DNA Polymerase (5U/μl from Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Cell Biology 2022Quote: ... Purified recombinant plasmid DNA was digested with PacI and transfected into HEK293 cells with Lipofectamine (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Recombinant antibodies were transiently transfected and produced in vitro in 293F Freestyle suspension cells (Thermofisher Scientific). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... and recombinant expression was undertaken using the FreeStyle™ MAX 293 Expression System (Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2019Quote: ... iPSC line WTC-11 (Coriell Institute) was maintained on recombinant human vitronectin[36,37](Thermo Fisher Scientific), coating six-well tissue culture plastic plates (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... The positive control consisted of 100 – 500 ng recombinant Protein A (ThermoFisher Scientific, Santa Clara, CA). The negative control consisted of ~2 μg wt-TMV from purified N ...
-
bioRxiv - Biochemistry 2021Quote: ... Clarified cell supernatant containing recombinant mAb was passed over Protein A Agarose resin (Thermo Fisher Scientific). Protein A resin was extensively washed with 25 mM Phosphate pH 7.4 ...
-
bioRxiv - Zoology 2021Quote: ... The recombinant plasmid was quantified using a NANO-DROP 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). The plasmid copy number was calculated using the equations described by Yun et ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant human TNF-α a well established trigger of HIV-1 reactivation was purchased from Gibco. The PKC activator Bryostatin and Sodium Butyrate (NaBu ...
-
bioRxiv - Plant Biology 2020Quote: ... Semi-quantitative PCR was performed within the linear amplification phase using a recombinant Taq Polymerase (Invitrogen) amplifying a fragment of 323 base pairs (bps ...
-
bioRxiv - Microbiology 2020Quote: Mice engrafted with J-Lat cells were treated with recombinant human TNF-α (Cat. #PHC3011, Gibco), a potent and well-known LRA ...
-
bioRxiv - Cell Biology 2021Quote: ... The amplification reactions for qualitative PCR were performed using Recombinant Taq DNA polymerase (Invitrogen, 11615-038) according to the following parameters ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant bacmids encoding each RBDs were generated using the Bac-to-Bac system (Thermo Fisher Scientific) followed by transfection into Sf9 cells using FuGENE HD (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant Cripto protein or transfected with Cripto expression plasmid (pcCripto) using Lipofectamine2000 (Life Technologies, Carlsbad, USA) according to the manufacturer`s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant protein concentration was quantified through BCA protein assay kit (Thermo Fisher Scientific, Buenos Aires, Argentina) on a BioRad 3350 Microplate Reader using BSA as standard ...