Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 10000+ citations for Recombinant Human PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Neuroscience 2024Quote: beta Amyloid Recombinant Rabbit Monoclonal Antibody (H31L21) (#700254, Thermo Fisher Scientific), Anti-GFAP antibody (#ab4674 ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μL 40 U/μL RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, #10777-019), and 1μL 200 U/μL SuperScript III Reverse Transcriptase ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Bioengineering 2024Quote: Recombinant BV were produced using the Bac-to-BacTM system (Invitrogen) as described38 ...
-
bioRxiv - Genomics 2024Quote: ... 1 uL of 100 mM RNaseOUT Recombinant Ribonuclease Inhibitor (10777019, Invitrogen) and 1X Maxima buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant bacmids were generated using the Bac-to-Bac system (Invitrogen) and transfected into Sf9 insect cells to produce baculovirus stocks ...
-
bioRxiv - Cell Biology 2024Quote: ... to generate recombinant baculovirus with the Bac-to-Bac system (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... recombinant mouse Interleukin-6 (IL-6, 4 ng/mL, Thermo Fisher), recombinant human FMS like tyrosine kinase 3 ligand (FLT3-L ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Cancer Biology 2024Quote: ... human CD3-PE (Invitrogen), and mouse CD45-erpCP Cy5.5 (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human HPRT1 (4326321E) (Invitrogen) was used as a reference gene ...
-
bioRxiv - Developmental Biology 2021Quote: ... C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat. No. V800-20, Invitrogen). The others were TA-cloned to pcDNA3.1/V5-His TOPO TA vectors (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the Ion PI™ Hi-Q™ OT2 200 kit (Invitrogen; Cat #A26434) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... incubated with DPBS containing 10% HI FBS and 1:1000 Hoechst 33342 (Invitrogen, #H3570) for nuclear staining and mounted onto microscope cover slips with Fluoromount G (Southern Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% heat-inactivated fetal bovine serum [HI-FBS] (Cat#SH30071.03, Thermo Scientific), penicillin [100 IU/ml]-streptomycin [100 ug/ml] (Quality Biological ...
-
bioRxiv - Immunology 2021Quote: ... The extracellular domain of NKp46 was cloned into pcDNA Myc-His 3.1a vector (Invitrogen) or pCMV vector (Addgene plasmid #59314 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cleared lysate was incubated with 1mL His-Pur nickel-NTA resin (Thermo Fisher) with rotation at 4 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... ZAP-S and ZAP-L were subcloned into pEF1-V5/His (Thermo Fisher Scientific) via the KpnI/XbaI sites to generate pEF1-ZAP-S-V5/His and pEF1-ZAP-L-V5/His ...
-
bioRxiv - Neuroscience 2022Quote: ... the pEx-FGD4-His-V5 vector was generated by Gateway cloning technology (Thermofisher, USA). Transfection experiments were performed using promofectin reagent (#PK-CT-2000-50 ...
-
bioRxiv - Synthetic Biology 2022Quote: All antigens were His-tagged and purified using HisPur™ Ni-NTA resin (ThermoFisher). Cell supernatants were diluted with 1/3rd volume wash buffer [20 mM imidazole ...
-
bioRxiv - Immunology 2022Quote: ... unbiotinylated form were incubated with 2μg/mL anti-His biotin (Invitrogen, MA1-21315-BTIN) for 20 min at room temperature before being used to label the streptavidin beads ...
-
Assessment of Human Renal Transporter Based Drug-Drug Interactions Using Proximal Tubule Kidney-ChipbioRxiv - Cell Biology 2022Quote: ... Heat inactivated fetal bovine serum (HI FBS) and trypan blue were procured from Gibco Life Technologies (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10% heat inactivated fetal bovine serum (HI-FBS, Life Technologies unless indicated), 100 U/mL penicillin-streptomycin ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the blot was incubated with HRP conjugated anti-His antibody (Invitrogen, LOT 1902132) at 1:5000 dilutions for 16h at 40 C ...
-
bioRxiv - Cancer Biology 2020Quote: ... HA-tagged RON was cloned into the expression vector pcDNA3.1/V5-His-TOPO (Invitrogen) by fusion PCR ...
-
bioRxiv - Microbiology 2020Quote: ... 1U Platinum High Fidelity (Hi-Fi) proof reading Taq polymerase (Invitrogen, Carlsbad, CA, USA). Two colonies of each G ...