Labshake search
Citations for Thermo Fisher :
2051 - 2100 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... Infiltrated leaves were collected 5 days after infiltration and homogenised with virus inoculation buffer (10 mM monopotassium phosphate containing 1% Celite (Thermo Fisher Scientific, 68855-54-9)) ...
-
bioRxiv - Microbiology 2023Quote: Epimastigotes and trypomastigotes lysates containing 2 x 107 parasites in 20 µL of SDS-PAGE sample buffer containing 5 mM DTT were boiled for 5 min and loaded onto precast Novex Value 4-12% Tris-Glycine gels (Thermo Fisher). The electrophoresis was performed in 50 mM MOPS-50 mM Tris Base ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... cycling synaptic vesicles were stained with the styryl dye N-(3-triethylammoniumpropyl)-4-(4-(dibutylamino) styryl) pyridium dibromide (FM1-43; Molecular Probes, Inc., Eugene, OR). For labeling of synaptic vesicles ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was isolated from gastrocnemius muscles of experimental mice (n=4 BC-PDOX; n=4 BC-PDOX PIO; n=3 NSC-Con) using Trizol (ThermoFisher Scientific, Waltham, MA, USA) and established methods21 ...
-
bioRxiv - Cell Biology 2022Quote: The 3’UTR of Aurora B was amplified with PCR using sea urchin cDNA and cloned into the ZeroBlunt vector (ThermoFisher Scientific, Waltham, MA) (Table 1 Primers) ...
-
bioRxiv - Cell Biology 2021Quote: ... and were cultured at 37°C under 5% CO2 in DMEM supplemented with 10% FCS and 100 μg/mL of hygromycin B (Invitrogen, 10687010).
-
bioRxiv - Molecular Biology 2022Quote: ... streptavidin particles with immobilized peptides were washed three times with buffer B (PBS pH 8.3, 5% glycerol, 1 mM DTT, 0.1% NP-40, Pierce™ Phosphatase Inhibitor Mini Tablets (Thermo Fisher Scientific), Roche Complete Mini EDTA-free protease inhibitor tablets (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... except that some preparations were made using donor T cells that were activated for 48 hours before virus infection using LentiBoost (5 μl each of solutions A and B per ml of cells transfected; Fisher Scientific). 100 units/ml IL-2 was added at the start of the activation procedure and with every media change during the expansion phase.
-
bioRxiv - Biochemistry 2020Quote: ... cells were incubated with an alpha tubulin monoclonal antibody conjugated to Alexa Fluor 488 (B-5-1-2, Invitrogen, Carlsbad, CA) at 2 μg/mL in 1% BSA in PBS for 1 hour ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% ACN) and buffer B (100 % ACN) and interfaced online with the Orbitrap Exploris 480 MS (Thermo Fisher Scientific, Bremen, Germany) using Xcalibur (tune version 3.0) ...
-
bioRxiv - Pathology 2024Quote: ... Protein samples were denatured at 70° C for 10 min after combining with 5% b-mercaptoethanol and 1X NuPAGE™ LDS Sample Buffer (Cat. No. NP0007, ThermoFisher) and run in 4-12% Bis-Tris gels (Cat ...
-
bioRxiv - Biophysics 2023Quote: ... the cell pellet was fully resuspended in 5 mL of B-PER complete bacterial protein extraction reagent (Thermo Fisher Scientific, #89821) containing 2 mM MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: For flowcytometric quantification of GFP signal in induced 3D7-DiCre pFIO/pFIO+ strains 2.5 µl iRBCs were washed once with RT 0.9% NaCl solution (B. Braun GmbH) and stained with 5 µM SYTO 61 Red Fluorescent Nucleic Acid stain (Thermo Fisher Scientific) for 1 h at 37°C in 0.9% NaCl solution and washed once again afterwards at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats were anesthetized using vaporized isoflurane and bilaterally injected with 5 µg of Alexafluor-555 labeled fluorescent choleratoxin subunit b (fCTb) (Invitrogen C34776) into the left and right side of the ARC using the following coordinates from bregma ...
-
bioRxiv - Microbiology 2023Quote: ... and ATTO647N (Atto-Tec) were dissolved in DMSO (10 and 5 mg.mL-1, respectively) while octadecyl rhodamine B chloride (R18, Thermo Fisher Scientific) was dissolved in ethanol (10 mM).
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
bioRxiv - Systems Biology 2019Quote: ... 5’-ACG UGA CAC GUU CGG AGA Att-3’) by Lipofectamine 2000 (Thermo Fisher, #11668019) 48 hr before performing experiment.
-
bioRxiv - Cell Biology 2019Quote: ... CAP-D3 (5-CAUGGAUCUAUGGAGAGUATT-3)29 and control15 were transfected using Oligofectamine transfection reagent (Invitrogen) according to the manufacturer’s instructions and analysed 48h after transfection ...
-
bioRxiv - Genetics 2019Quote: ... 5’ -6FAM CTC AGA GAC ATA TCA AAG ATT CCA GGG-MGB-3’ (Life Technologies). Viral load is expressed on a Log10 scale as viral genome copies per milliliter (plasma samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Cell Biology 2019Quote: ... for 5 min and separated on a 3-8% tris-acetate gel (ThermoFisher Scientific; EA0375BOX). Following electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... Primer 2: 5’-GGATGTTCGTCCAGTGAGATTAG-3’) using a 7500 Fast Real-Time PCR System (Applied Biosystems) and accompanying software to analyze qPCR data.
-
bioRxiv - Synthetic Biology 2019Quote: ... and MIT_v2.1_SbfInifJ_RV2 5’-AACCTGCAGGGCTAACTAACTAACCACGGACAAAAAACC-3’) and ligated into pCR Blunt II TOPO (Thermo Fisher Scientific). The second half containing nifBQFUSVWZM was amplified with SbfI sites on either end (with oligos MIT_v2.1_SbfInifB_FW 5’-AACCTGCAGGTACTCTAACCCCATCGGCCGTCTTA-3’ ...
-
bioRxiv - Developmental Biology 2019Quote: For live imaging 3-5 day old flies were dissected in Schneider’s Insect Media (Thermofisher) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then 3 hours at 37°C with 5 μg/mL mouse laminin (Thermo Fisher). Neurons are cultured in BrainPhys neuronal medium (Stemcell Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Fluorescence was measured using a QuantStudio 3 or QuantStudio 5 qPCR machine (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... 5 × 106 cells were cultured in 3 ml Dulbecco’s modified Eagle’s medium (DMEM) (Life Technologies) supplemented with 10% fetal bovine serum (Life Technologies).
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 μL of a heavy-weight dextran (Invitrogen, Cat#D1818, 70,000 MW, lysine fixable) was injected into each juvenile octopus and allowed to circulate throughout the body for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
bioRxiv - Bioengineering 2024Quote: ... GAPDH reverse: 5′-AAG TGG TCG TTG AGG GCA ATG -3′ (Invitrogen, Thermo Fisher Scientific); ALIX forward ...
-
Tumor microenvironment acidosis favors pancreatic cancer stem cell properties and in vivo metastasisbioRxiv - Cancer Biology 2024Quote: ... and the cells resuspended in 3-5 mL of pancreatosphere medium (DMEM/F12 (Gibco, #11320033), 1% P/S ...
-
bioRxiv - Plant Biology 2024Quote: ... Cells were disrupted by passing them 3-5 times through a French press (Thermo Fisher) and centrifuged for 50,000g for one hour at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 48 hours after transfection cells were splitted in a ratio of 1:4 and 300 μg/ml Hygromycin B (Thermo Fisher Scientific) was added to the cell culture medium for antibiotic selection of stably transfected cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... A431RON (Figure 3A-B and 4) or A431RON-K1114M (Figure S3B) cells were seeded in 8-well chamber slides (Nunc Lab-Tek) at a density of 30,000/well and allowed to adhere overnight ...
-
bioRxiv - Immunology 2020Quote: ... At day 4 and day 10 of culture B cells were mixed with at least 2000 Cyto-Cal counting beads (Thermo Fisher Scientific) or CountBright Absolute counting beads (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... After selection for 2 weeks in DMEM supplemented with hygromycin B (250 μg/ml; Carl Roth) and blasticidin (4 μg/ml; Thermo Fisher Scientific), single-cell colonies were isolated ...