Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... and 1 Step Ultra-ELISA TMB substrate (ThermoFisher).
-
bioRxiv - Microbiology 2023Quote: ELISA plates (96-well flat-bottom; Nunc Maxisorp) were coated overnight at 4 °C on an orbital shaker with 100 ng/mL solutions (in PBS ...
-
bioRxiv - Immunology 2024Quote: ... 1-Step Ultra TMB-ELISA substrate solution (ThermoFisher) was added to develop for 5 minutes and quenched with 2N sulfuric acid (VWR) ...
-
bioRxiv - Bioengineering 2024Quote: ... and assayed with an IL-10 ELISA (Invitrogen). IL-10 and Fab-IL-10 generated in our laboratories served as the standards for their respective ELISAs ...
-
bioRxiv - Biophysics 2024Quote: ... MaxiSorp flat-bottom 96-well ELISA plates (ThermoFisher) were coated with recombinant TcPOP (2 µg/mL in PBS ...
-
bioRxiv - Immunology 2024Quote: ... Samples were blocked with ELISA blocking diluent (Invitrogen) for 2 hr at 37°C then washed 3X ...
-
bioRxiv - Microbiology 2022Quote: ... SuperSignal™ ELISA Femto Maximum Sensitivity Substrate (ThermoFisher) was added to plates following manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... SuperSignal™ ELISA Femto Maximum Sensitivity Substrate (ThermoFisher) was added to plates following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... One-step TMB-ELISA (34028, ThermoFisher, MA, US) was used to detect absorbance on a plate reader at 650 nm.
-
bioRxiv - Microbiology 2023Quote: Nunc MaxiSorp flat-bottom ELISA Plates (ThermoFisher Scientific) were coated with 100µl of rNDPK at 1µg/ml in PBS overnight at 4°C or PBS alone ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates (Immulon 4 HBX, Thermo Fisher Scientific) were coated with PBS or 2 μg/mL recombinant protein and stored overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: Indirect ELISA was performed in MaxiSorp plates (Nunc) pre-coated with human H3K27M and H3wt (p14-40 ...
-
bioRxiv - Immunology 2023Quote: ... ELISAs were developed using ABTS solution (Thermo Fisher) and absorbance was measured at 415 nm and 695 nm by a plate reader (Tecan) ...
-
bioRxiv - Immunology 2024Quote: ... 384-well Maxi-Sorp ELISA plates (ThermoFisher Nunc) were coated with recombinantly expressed protein at a concentration of 3 μg per ml and incubated overnight at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... 384-well Maxi-Sorp ELISA plates (ThermoFisher Nunc) were coated with recombinantly expressed protein at a concentration of 3 μg per ml and incubated overnight at 4 °C ...
-
bioRxiv - Microbiology 2024Quote: ... 96-well round-bottom ELISA plates (Nunc Maxisorp) were used ...
-
bioRxiv - Immunology 2024Quote: ... wells of Immulon 2 ELISA plates (ThermoFisher Scientific) were coated with 250ng protein in 50µL 1xPBS and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... developed with 1-Step Ultra TMB-ELISA (ThermoFisher) and imaged using the Synergy HI plate reader with the absorption set at O.D ...
-
bioRxiv - Immunology 2024Quote: ... MaxiSorp Nunc ELISA plates (Fisher Scientific, Hampton, NH) were coated with 100 ng of either recombinant fusion protein (rF1V ...
-
bioRxiv - Molecular Biology 2024Quote: Ninety-six-well ELISA plates (Nunc MaxiSorp, ThermoFisher) were coated with 100 ng of full-length Spike protein or the receptor-binding domain (RBD ...
-
bioRxiv - Biochemistry 2024Quote: ... TMB (1-Step Ultra TMB-ELISA, Thermo Scientific) was added ...
-
bioRxiv - Molecular Biology 2024Quote: Ninety-six-well ELISA plates (Nunc MaxiSorp, ThermoFisher) were coated with 100 ng of full-length Spike protein or the receptor-binding domain (RBD ...
-
bioRxiv - Cancer Biology 2021Quote: ... and was reverse transcribed with Superscript III (Invitrogen). Quantitative RT-PCR was performed in an iCycler (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... and cDNA was generated with SuperScript III (Invitrogen) as previously described 45.
-
bioRxiv - Immunology 2021Quote: ... for and reverse transcribed with Superscript III (Invitrogen). Quantitative PCR was performed using SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and SuperScript III (Thermo Fisher Scientific, Waltham, MA). Oligonucleotide primers from Table S7 were used to amplify specific B ...
-
bioRxiv - Microbiology 2020Quote: ... and SuperScript III (Thermo Fisher Scientific, Waltham, MA). Oligonucleotide primers for bbd18 and bbd21 (Table S7 ...
-
bioRxiv - Immunology 2021Quote: ... and reverse transcribed using SuperScript III (Life Technologies) at 50°C for 50 minutes followed by incubation at 85°C for 10 minutes to inactivate the reverse transcriptase.
-
bioRxiv - Evolutionary Biology 2020Quote: ... cDNA was generated using SuperScript III (Thermo Fisher) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA libraries were made using SuperScript-III (Invitrogen). qPCR was performed using SYBR green reagent (Roche ...
-
bioRxiv - Developmental Biology 2020Quote: ... and reversed transcribed using Superscript III (Invitrogen, 18080093) and random hexamers (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... it was retrotranscribed by Super-Script III (Invitrogen) using random hexanucleotides as primers ...
-
bioRxiv - Genomics 2020Quote: ... RNA was reverse transcribed with SuperScript III (Invitrogen) with the RT primer 5’ CCTTGGCACCCGAGAATTCCA ...
-
bioRxiv - Genomics 2020Quote: ... followed by reverse transcription with Superscript III (Invitrogen) using dT(20 ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.25μl SuperScript III Reverse Transcriptase (Life Technologies) were incubated for 30 min at 42°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was reverse transcribed with Superscript III (Invitrogen) into cDNA using the BGH reverse primer in the vector (5’-tagaaggcacagtcgagg-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... (iii) 0.5 mg/ml NeutrAvidin (31000; Thermo Fisher), (iv ...
-
bioRxiv - Cell Biology 2021Quote: ... and cDNA was synthesised using SuperScript III (Invitrogen) according to manufacturer instructions ...
-
bioRxiv - Systems Biology 2021Quote: ... cDNA was prepared using SuperScript RT III (Invitrogen) with oligo dT primers ...
-
bioRxiv - Physiology 2021Quote: ... with Superscript III First-Strand Synthesis System (Invitrogen). The cDNA synthesis protocol was performed in two steps ...
-
bioRxiv - Microbiology 2021Quote: ... SuperScript III reverse transcriptase and random primers (Invitrogen) were used to perform reverse transcription ...
-
bioRxiv - Molecular Biology 2020Quote: ... SuperScript™ III reverse transcriptase (Thermo Fisher Scientific) was used to produce cDNA from viral RNA using a primer (pLAI-JRFL-NefOR-rev ...
-
bioRxiv - Neuroscience 2020Quote: Complementary DNA was synthesized by Superscript III (Invitrogen) reverse transcriptase with the addition of Ribolock RNase inhibitor (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... using the SuperScript III Reverse Transcriptase (ThermoFisher, #18080093) or Superscript VILO cDNA master mix (Thermofisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cDNA was synthesized using Superscript III (Invitrogen) according to the manufactures’ instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... FFPE sections were stained with Hematoxylin and Eosin and-scanned by Thermo Fisher (Panoramic 250 Flash III, Thermo Fisher, Tewksbury, MA) scanner and adipocyte area of N=50 adipocytes were quantified using software (Case Viewer ...
-
bioRxiv - Biochemistry 2022Quote: ... equipped with a Falcon III detector (Thermofisher Scientific). Typically ...
-
bioRxiv - Microbiology 2022Quote: ... Following the Superscript III reverse transcriptase protocol (Invitrogen), equal amounts of total RNA (1 μg ...
-
bioRxiv - Cell Biology 2022Quote: ... and cDNA was synthesised using Superscript III (Invitrogen). RT-PCR was used to confirm the absence of full-length transcripts in the T-DNA mutants using the primers listed in Supplementary Table S1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and SuperScript III reverse transcriptase (Thermo Fisher Scientific) was used for cDNA synthesis according to manufacturer’s instructions ...