Labshake search
Citations for Thermo Fisher :
2001 - 2050 of 10000+ citations for Human High Sensitive Interleukin 8 IL8 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... following the instructions available in the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems®). Real-time Polymerase Chain Reaction (qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... cDNA was synthesized using Applied Biosystems High Capacity cDNA reverse transcription kit (Thermo Fisher, 4368814) based on the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... and reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Waltham, USA). Semi-quantitative Reverse Transcription PCR (RT-qPCR ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cDNA was prepared using a High-Capacity cDNA Reverse Transcription kit (Thermo-Fisher Scientific, 4368814). qPCR was performed using KAPA SYBR FAST Universal (Sigma Aldrich ...
-
bioRxiv - Physiology 2024Quote: ... Reverse transcription was performed with the High-Capacity RNA-to-cDNA Kit (4387406 Thermofisher scientific) as shown previously44 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was generated using the High-Capacity cDNA Synthesis Kit (Thermo Fisher Scientific; REF 4368814) in a T100TM Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The pHrodo-TDM1 was obtained by conjugating the free lysine residues of TDM1 with the amine-reactive pH-sensitive pHrodo iFL Red STP ester dye (ThermoFisher Scientific, P36014) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: Intracellular pH (pHi) measurements were performed by monitoring intracellular free H+ concentration using the pH-sensitive fluorescent dye BCECF-AM (B1170; Thermo Fisher Scientific) as described previously.19,20 Details of the experimental setup and solutions used are provided in the Supplementary Materials.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: HEK-293 cells or HEK-293 cells stably expressing PAR4-YFP were loaded with calcium sensitive dye (Fluo-4 NW, F36206, Life Technologies, Thermo Fisher) and aliquoted into cuvettes with Hanks buffered salt solution (HBSS containing Ca2+ and Mg2+) ...
-
bioRxiv - Cancer Biology 2020Quote: Endogenous ROS levels of the cell lines were measured by labeling 5×105 cells for 30minutes at 37°C with redox-sensitive probes CellRox (5µM) (Life Technologies, NY, USA). Stained cells were washed twice with PBS and analyzed using Beckman Coulter Gallios flow cytometer (Becton Dickinson ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Membranes were then washed three times with 1x TBST for ten minutes per wash and signals were measured using an ultra-sensitive enhanced chemiluminescent (Thermofisher Cat#34096) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... 12mm circular glass coverslips containing cells were incubated at room temperature for 20 min with the Ca2+-sensitive dye Fura-2-AM (Invitrogen, 2 μM), dissolved in standard extracellular HEPES-buffered HBSS (known hereafter as extracellular imaging buffer ...
-
bioRxiv - Immunology 2022Quote: ... splenocytes were isolated and stained with 1 µM MitoSOX Red (superoxide sensitive mitochondrial-localized probe, Thermo Fisher Scientific #M36008, Waltham, MA, USA) and cell type discriminating fluorescent antibodies CD19 APC-Cy7 ...
-
bioRxiv - Neuroscience 2022Quote: ... and their CA1 region bolus-stained with the Na+ sensitive dye SBFI-AM (sodium-binding benzofuran isophthalate-acetoxymethyl ester; Invitrogen, Karlsruhe, Germany). SBFI was alternatively excited at 340/380 nm at an imaging frequency of 0.5 Hz and emission was collected >440 nm from defined regions of interest (ROIs ...
-
bioRxiv - Physiology 2023Quote: ... Cells were then spun at 350 x g for 4 min and resuspended in 1 mL FSW with 10 µM pH-sensitive cell dye SNARF-1 acetoxymethyl ester acetate (Invitrogen, Thermo Fisher Scientific) and 0.1% dimethylsulfoxide (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... human (Invitrogen). Cells were cultured in DMEM (Corning Cellgro 10-013-CV ...
-
bioRxiv - Bioengineering 2020Quote: ... high glucose (Gibco) supplemented with 10% FBS and 1X Antibiotic-Antimycotic ...
-
bioRxiv - Biochemistry 2020Quote: ... high glucose (Gibco) containing 10% fetal bovine serum (Life Sciences) ...
-
bioRxiv - Biochemistry 2022Quote: ... high glucose (Gibco) with the addition of 10% Fetal Bovine Serum (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... high glucose (GIBCO), half OptiMEM 1 (Gibco ...
-
bioRxiv - Biochemistry 2021Quote: ... high glucose (Gibco)] supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2020Quote: ... High Fidelity (ThermoFisher) and purified using Qiagen PCR purification or Qiagen Gel extraction kits.
-
bioRxiv - Microbiology 2020Quote: ... High Sensitivity (Invitrogen). DNA library quality control was performed using a Tapestation 2200 with a High Sensitivity D1000 kit (Agilent Technologies ...
-
bioRxiv - Bioengineering 2021Quote: ... high glucose (Gibco) supplemented with 10% FBS and 1X Antibiotic-Antimycotic ...
-
bioRxiv - Biophysics 2019Quote: ... high glucose (Gibco) supplemented with 10% horse serum (CellGro) ...
-
bioRxiv - Neuroscience 2021Quote: ... high glucose (Gibco) with 5% serum and 1% Pen/Strep.
-
bioRxiv - Cell Biology 2020Quote: ... high glucose (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: ... high glucose (Gibco) containing 10% fetal bovine serum (HyClone ...
-
bioRxiv - Systems Biology 2022Quote: ... High Sensitivity (ThermoFisher). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... High Fidelity (Invitrogen) and 10x AccuPrimeTM PCR Buffer II in combination with gene specific primers (at 10 µM each ...
-
bioRxiv - Genetics 2023Quote: ... high glucose (Gibco 11965084 ...
-
bioRxiv - Cell Biology 2023Quote: ... high glucose (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... high glucose (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... One µg of total RNA was retrotranscribed into complementary cDNA using an RT-PCR kit (High capacity cDNA rt Kit, Applied Biosystems). Quantitative PCRs were carried out in triplicate of each sample using 40 ng of cDNA per well ...
-
bioRxiv - Developmental Biology 2020Quote: ... The libraries were profiled with High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, #DNF-474) and measured with Qubit dsDNA HS Assay Kit (Invitrogen, #Q32851) prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was isolated using the RNeasy Micro kit and cDNA synthesized a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Targeted qPCR was performed using the QuantStudio 6 Real-Time PCR system using the following Taqman Primers (Applied Biosystems) ...
-
bioRxiv - Genomics 2019Quote: ... The libraries were profiled with High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, #DNF-474) and measured with Qubit dsDNA HS Assay Kit (Invitrogen, #Q32851) prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT ...
-
bioRxiv - Cancer Biology 2019Quote: ... total RNA was isolated using E.Z.N.A.® MicroElute Total RNA Kit (Omega Bio-tekkit) and transcribed into complementary DNA using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time PCR reactions were carried out using 1x GoTaq™ qPCR Master Mix (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... Library quality and quantification was assessed on the Agilent Fragment Analyzer using a High Sensitivity NGS Kit (DNF-474) and a Qubit 4 RNA BR kit (Thermo Fisher). Samples were then normalized to 4nM and pooled in equimolar amounts ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was extracted from iPSC cells using the NucleoSpin RNA kit (Machery-Nagel) and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Life Technologies). qRT-PCR was performed on all the TTLL/CCP fragments generated from primers designed in supplementary figure 5 and the housekeeping control GAPDH (GAPDHFOR 5′ − GAAGGTGAAGGTCGGAGT − 3′ and GAPDHREV 5′GAAGATGGTGATGGGATTTC − 3′).
-
bioRxiv - Immunology 2022Quote: ... or Single Cell RNA purification Kit (Norgen 51800) and reverse transcription was performed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) by following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: Total RNA was isolated from cells by using a Qiagen RNeasy kit and then reverse transcribed to generate cDNA with the High Capacity cDNA kit (Applied Biosystems). Quantitative PCR was performed by using SYBR green (Quanta Biosciences ...
-
bioRxiv - Bioengineering 2022Quote: ... cDNA was synthesized from 10 ng of the total RNA with a commercially available kit (High-Capacity cDNA Reverse Transcription Kit, Thermo Fisher). Quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2022Quote: ... High-Capacity cDNA Reverse Transcription Kit and Mir-X™ miRNA First Strand Synthesis Kit were purchased from Applied Biosystems (USA) and Takara (China ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were tested for average fragment length using Agilent High Sensitivity DNA Kit (5067-4626) and concentration was tested using Qubit™ dsDNA HS kit (#Q32851, Invitrogen). DNA was stored at −20°C until used for sequencing ...
-
bioRxiv - Cell Biology 2023Quote: RNAs extracted by either Trizol or RNeasy Plus Micro Kit were reverse transcribed to cDNAs using High-Capacity cDNA Reverse Transcription Kit (4368814; Applied Biosystems), and quantitative PCR was performed using DyNAmo Flash SYBR Green qPCR Kit (F415S ...
-
bioRxiv - Cell Biology 2023Quote: ... The resulting libraries were profiled using a High Sensitivity NGS Fragment Analysis Kit (Advanced Analytical, #DNF-474) and measured using a Qubit dsDNA HS Assay Kit (Invitrogen, #Q32851) prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75Lcycles ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized using PureLink™ RNA Mini Kit and High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher scientific, USA) respectively ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA quality was assessed via Agilent Fragment Analyzer analysis using a High Sensitivity RNA analysis kit (DNF-472) and quantified using a Qubit 4 RNA BR kit (Thermo Fisher). RNA libraries were prepared with 500 ng total RNA ...
-
bioRxiv - Microbiology 2023Quote: ... DNA from both size fractions were extracted using the MoBIO PowerWater DNA kit (MoBIO, USA) and quantified using the Qubit high-sensitivity dsDNA assay kit (ThermoFisher, USA). DNA was frozen at −20°C until sequencing ...