Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 7068 citations for TMEM173 Human HEK293 Sumo His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Normal human melanocytes were grown in Melanocyte Growth Media 254 supplemented with Human Melanocyte Growth Supplement-2 (Life Technologies), calcium chloride (0.3 μM) ...
-
bioRxiv - Immunology 2023Quote: ... they were incubated for 10 min at room temperature with a combined Fc block solution (2μL Human Fc block [BD Biosciences, San Jose, CA, USA] + 3μL heat-inactivated human AB serum [Fisher Scientific, Waltham ...
-
bioRxiv - Cell Biology 2023Quote: Human umbilical vein endothelial cells (HUVECs) and human coronary artery smooth muscle cells (HCASMCs) were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Molecular Biology 2023Quote: ... human breast cancer MCF7 cells and human bone osteosarcoma U2OS cells were in cultured in DMEM medium (Life Technologies) supplemented with 10% (v/v ...
-
bioRxiv - Immunology 2024Quote: ... corresponding to the concentration of the highest standard of recombinant human IFNγ (Human IFNγ Gamma Uncoated ELISA kit, Invitrogen). IFNγ concentrations below the level of detection by the ELISA standard curve were set to 0 pg/ml ...
-
bioRxiv - Neuroscience 2024Quote: ELISAs for human Aβ40 and human Aβ42 were carried out using commercial kits (Aβ40: Invitrogen KHB3481; Aβ42: Invitrogen KHB3441) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF of red fluorescent protein gene (RFP)-fused Antp was inserted into a pIZ/V5-His vector (Invitrogen) driven by the OpIE2 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the C-terminal foldon trimerization motif followed by an 8×His-tag was cloned into the pcDNA3.1(+) expression vector (Invitrogen). Furthermore ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tagged Gβγ was expressed in Sf9 cells for 2 days following baculovirus infection (pFastBacDual, Bac-to-Bac, Invitrogen). Cells were harvested by centrifugation and lysed by sonication in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2020Quote: His-tagged P-Rex2 was expressed in Sf9 cells for 2 days following baculovirus infection (Bac-to-Bac, Invitrogen). Cells were harvested by centrifugation and lysed by sonication in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... extended with a nucleic acid sequence encoding for 6 histidine residues (His-tag) and cloned into the mammalian expression vector pcDNA3.1(+) (Invitrogen). The soluble antigen was produced by transient gene expression in CHO cells as described previously [38] and purified from the cell culture medium by Ni-NTA resin (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder, Applied Biosystems, in 10 μL of Hi-Di formamide ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder [Applied Biosystems] in 10 μL of Hi-Di formamide [Applied Biosystems] ...
-
bioRxiv - Biochemistry 2020Quote: ... Binding of the full-length S protein was detected by mouse anti-His IgG (Invitrogen MA121315, 2 μg/ml) and Alexa Fluor-488-labelled goat anti-mouse IgG (Invitrogen A11001 ...
-
bioRxiv - Biochemistry 2020Quote: ... Purified PCR products were digested with XhoI and NheI and inserted into the pcDNA6/V5-His expression vector (Invitrogen) generating plasmid pMBA40 for POMGNT1 complementation ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA libraries were pooled for emulsion PCR using an Ion PI Hi-Q Chef Kit (Thermo Fisher Scientific). The enriched samples were loaded onto an Ion PI chip v3 with Ion Chef ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing was performed on the Ion Torrent PGM with the Ion PGM Hi-Q View Sequencing kit (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA-Seq templates were prepared using the Ion PGM Hi-Q View OT2 Kit (Thermo Fisher Scientific Inc.) on an Ion OneTouch 2 system ...
-
bioRxiv - Microbiology 2020Quote: 293F cells were transfected by plasmids pOptiVec/V5-His WEAU gp120-trimer using 293fectin according to the manufacturer’s (Invitrogen) instructions ...
-
bioRxiv - Immunology 2022Quote: ... Splenocytes were stored down by resuspending cells in freezing media (HI-FBS with 10% DMSO, Fisher Scientific, BP231-100) in aliquots of 5-10 x106 cells per ml and frozen down to -80°C at a speed of 1°C/min prior to storage in liquid nitrogen.
-
bioRxiv - Immunology 2022Quote: ... and C-terminal foldon trimerization motif followed by hexa-His tag) were used to transiently transfect Expi293F cells (Gibco). Four days after transfection ...
-
bioRxiv - Immunology 2022Quote: ... two alpacas were five times immunized with 200 µg His-NLRP1PYD using Imject™ Alum Adjuvant (Thermo Fisher Scientific) according to locally authorized protocols ...
-
bioRxiv - Immunology 2022Quote: ... The plate was coated with 2 µg/mL mouse anti-His antibody (Invitrogen cat. #MA1-21315-1MG, ThermoFisher Scientific) overnight at 4°C ...
-
bioRxiv - Plant Biology 2022Quote: ... fused with an N-terminal 6×His-tag and cloned into expression vector pPIC9 (Thermo Fisher Scientific, California, USA). Correctness of the resulting constructs was confirmed by DNA sequencing prior to introduction into Pichia pastoris strain GS115 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was confirmed by western blot using a 6x His-Tag HRP conjugated Monoclonal Antibody (Thermo Fisher Scientific). Once verified ...
-
bioRxiv - Cell Biology 2021Quote: ... reaction mixes were prepared using 2.5 μg recombinant His-ACBD5 with or without the addition of 0.3 mM ice-cold ATP (Thermo Fisher) and 0.1 ug GST-GSK3β (Abcam) ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Biophysics 2021Quote: Detergent extracted His-MBP-tagged proteins were applied to a 40 mL POROS MC 20 Ni2+ column (Applied Biosystems) equilibrated with buffer A (200 mM NaCl ...
-
bioRxiv - Systems Biology 2022Quote: HeLa cells and FUCCI -HeLa cells were cultured in DMEM medium (Hi Media, AT007) supplemented with 10% FBS (Gibco) and 1% Penicillin-Streptomycin (Hi Media, ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate including his-FAP-interacting peptides were collected and submit to a MS facility (Thermo Fisher, Inc.; USA) for analysis ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA4-V5-NAA80-M23L was constructed by subcloning NAA80 from pcDNA3.1-NAA80-V525 into the TOPO TA vector pcDNA 4/Xpress-His (Invitrogen). Then the M23L mutation was introduced and the N-terminal Xpress tag was replaced with a V5 tag ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 228-10481) cDNA was cloned into the BamHI-NotI of the pcDNA3.1(+)-myc-His expression vector (Invitrogen, CAT# V80020) yielding pcDNA3.1-BRCA2T (BRCA2/2662T) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The first round PCR reaction was performed by adding 1 µl of cDNA template to a 20 µl reaction containing 0.005 U of Platinum Taq Hi-Fidelity polymerase (Invitrogen) as previously described (59) ...
-
bioRxiv - Microbiology 2020Quote: ... An aliquot of 50 ng of purified HIV-1 env DNA was used to clone into the pcDNA 3.1D/V5-His-TOPO vector (Invitrogen) and MAX Efficiency Stlb2 competent cells (Life Technology ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Microbiology 2019Quote: Bacterially expressed ZIKV EDIII proteins (C-terminal 6 × His-tag) were conjugated to Ni-NTA Magnetic beads (Thermo Scientific) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... SmBChE1 and SmAChE3 (fSmChEs) were EcoRI/XbaI cloned into the C-terminal 6-His-tagged pPICZαA expression vector (Invitrogen) to facilitate secretory expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific) and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... hLIGHT (L83-V240) and mHVEM (Q39-T142) were separately cloned into the pMT/BiP/V5-His A vector (Invitrogen) and co-transfected into Drosophila S2 cells with the pCoBlast (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... FACS-sorted cells were suspended at 0.5×106 cells/mL in RPMI 1640 medium supplemented with 10% HI-FCS and 1% PenStrep (10378016; Gibco). CD14+HLA-DRneg/low/CD14+HLA-DRhigh monocytes were cultured in 96 well plates (200μL/well ...
-
bioRxiv - Immunology 2021Quote: ... Clonal amplification of the libraries was done using the Ion-PI-Hi-Q Sequencing 200 Kit (Thermo Scientific, USA) PCR emulsions ...
-
bioRxiv - Neuroscience 2023Quote: The plasmid for heterologous expression of fshr-1 in HEK cells was obtained by directionally cloning the fshr-1 cDNA into the pcDNA3.1/V5-His-TOPO vector (Invitrogen). The cDNA sequence of the fshr-1a gene isoform was amplified by PCR using cDNA from mix-staged wild-type C ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant AtGNL-6XHIS was detected using an anti-HIS (C-term)/AP antibody at a 1:2,000 v/v dilution (Invitrogen) and CDP-start ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then incubated for 1 h at room temperature with the following primary antibodies: mouse anti-His-Tag (dilution 1:1,000, clone HIS.H8, Invitrogen MA121315), mouse anti-Flag (dilution 1:1000 ...
-
bioRxiv - Genetics 2024Quote: ... and 15 µL of each eluate was mixed with the same volume of Hi-Di formamide (Thermo Fisher Scientific). Samples were finally sequenced either in one or in both directions on a 3500 Genetic Analyzer device (Applied Biosystems/Hitachi ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Systems Biology 2023Quote: ... and utilized Alt-R CRISPR-Cas9 crRNA/trRNA/Hi-Fi Cas9 ribonucleotide-protein complex (IDT) and Neon electroporation (ThermoFisher) to deliver the complex to the iPSC ...