Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 3589 citations for Non Ab Component of Alzheimer's Disease Amyloid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... 1% non-essential amino acids (NEAA; Fisher Scientific, 11-140-050), and 1% penicillin-streptomycin (P/S ...
-
bioRxiv - Cell Biology 2022Quote: ... and 1% non-essential amino acids (MEM NEAA, Thermo Fisher Scientific). Cells were maintained at 37°C and 5% CO2.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were blocked using 5% non-fat milk (ThermoFisher Scientific 50488785) made with 1% Tris-Buffered Saline Tween20 (TBST ...
-
bioRxiv - Immunology 2022Quote: ... 2 mM L-glutamine and 90% non-essential amino acids (Gibco), 10% heat-inactivated Fetal Bovine Serum (FBS ...
-
bioRxiv - Immunology 2022Quote: ... 100 μM Non-Essential Amino Acids (NEAA, Thermo Fisher Scientific, 11140050), 1 mM sodium pyruvate (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with MEM non-essential amino acid (#11140-050, ThermoFisher Scientific) and complemented with heat-inactivated Fetal Calf Serum (#A3840002 ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with MEM non-essential amino acid (#11140-050, ThermoFisher Scientific) with 10% of FBS and incubated at 28°C without CO2 ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with 5% FBS and non-essential amino acids (Life Technologies). At 4 d post-transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1x MEM Non-Essential Amino Acids Solution (NEAA, Gibco 11140076), and triple transfected with plasmid DNA encoding rep-cap ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1x non-essential amino acids (100x MEM NEAA, Gibco #11140-035), 1x Sodium pyruvate (100x ...
-
bioRxiv - Biophysics 2022Quote: ... and 1x non-essential amino acid solution (ThermoFisher Scientific, 11140-050) in a sterile environment at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... or ON-TARGET-plus Non-targeting siRNA #1 (Thermo Scientific Dharmacon). For transfection of siRNA-treated cells for biochemical or immunofluorescence analysis ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1% MEM non-essential amino acids (11140035, ThermoFisher, Paisley, Scotland, UK), 1% Penicillin-Streptomycin (P4333 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1:100 [v/v] MEM non-essential amino acid solution (Gibco), and 1:100 [v/v] GlutaMAX supplement (Gibco).
-
bioRxiv - Cell Biology 2022Quote: ... 1% MEM Non-Essential Amino Acids (NEAA) Solution (Thermo Fisher Scientific) and 10% FBS ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1X Non-Essential Amino Acid solution (Life Technologies, Gibco™).
-
bioRxiv - Biochemistry 2023Quote: ... and 1X Non-Essential Amino Acid solution (Life Technologies, Gibco™).
-
bioRxiv - Cancer Biology 2023Quote: ... Non-specific binding was blocked with normal mouse IgG (Invitrogen; 10400C) incubated with whole blood ...
-
bioRxiv - Systems Biology 2023Quote: ... 1X MEM Non-Essential Amino Acid solution (NEAA, Gibco™ #11140050) and filtered through a 0.22 µM PES membrane ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 × Minimum Essential Medium Non-Essential Amino Acids (MEM NEAA) (Gibco), 2-Mercaptoethanol (50 μM ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% MEM Non-essential amino acids (100x) (all Gibco Life Technologies) and IL-2 150U/ml (Proleukin ...
-
bioRxiv - Biochemistry 2023Quote: ... A non-reducing Bis-Tris 4-12% gradient gel (Thermo Scientific) was used to detect size-resolved spike proteins (Figure S1).
-
bioRxiv - Physiology 2023Quote: ... a non-selective blocker of Ca2+ influx (Fisher Scientific, Loughborough, UK); bradykinin (Merck) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 mM non-essential amino acids (NEAA, all Thermo Fisher Scientific), 0.1 μg/ml IGF-1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... or non-specific control siRNA oligos (Thermo Fisher Scientific, 100 pmole) using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... 0.1 mM MEM Non-Essential Amino Acids (Thermo Fisher Scientific # 11140050), 1 mM Sodium Pyruvate (Millipore Sigma # S8636) ...
-
bioRxiv - Genomics 2023Quote: ... Non-transduced cells were eliminated with hygromycin (100 μg/ml, GIBCO) and blasticidin (10 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... 1% Minimum Essential Medium Non-Essential Amino Acids (MEM-NEAA, Gibco), 1% Sodium Pyruvate (NaPyr ...
-
bioRxiv - Biochemistry 2023Quote: ... a mixture of seven non-essential amino acids (ThermoFisher Scientific, 11140050), 0.05 mM β-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... and 1X non-essential amino acids) using lipofectamine 2000 (Thermo Fisher) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% Non-essential amino acids (MEM NEAA, Gibco, Thermofisher, Waltham, MA), 1% penicillin/streptomycin (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% Non-essential amino acids (MEM NEAA, Gibco, Thermofisher, Waltham, MA), 1% penicillin/streptomycin (Gibco ...
-
bioRxiv - Cancer Biology 2023Quote: ... were compared to non-targeting negative control siRNA (siControl; Life Technologies). The siRNAs were reverse transiently transfected into SK-MEL-28 cells using Lipofectamine RNAiMAX® (Life Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stealth non-silencing Low-GC RNA duplexes (sictl, CGACAAUUGUGAGGUCUAAACUAUU, Life Technologies) were used as non-silencing control.
-
bioRxiv - Cancer Biology 2023Quote: ... 1% (vol/vol) MEM non-essential amino acids (Thermo Fisher Scientific), and 1% (vol/vol ...
-
bioRxiv - Biophysics 2022Quote: ... 1% v/v Non-Essential Amino Acid (Gibco, ref. 11140-050), 1% v/v sodium pyruvate (Gibco ...
-
bioRxiv - Cell Biology 2022Quote: ... and non-targeting siRNA control (Dharmacon: #D-001206-13-50, ThermoFisher Scientific ...
-
bioRxiv - Genetics 2023Quote: ... 1× MEM Non-Essential Amino Acids (Thermo Fisher Scientific, 11140-050), 10% FBS and 1% Pen-Strep at 37℃ in 5% CO2 ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... and 1% minimum essential medium non-essential amino acids (NEAA) (Gibco). All cells were maintained at 37°C in 5% CO2.
-
bioRxiv - Immunology 2023Quote: ... and 1% MEM non-essential amino acid solution (all ThermoFisher Scientific). Short-term cultured GNS cell lines were a kind gift from Professor Bryan Day (QIMR Berghofer Medical Research Institute ...
-
bioRxiv - Genomics 2023Quote: ... 1x Minimum Essential Medium Non-Essential Amino Acids (MEM NEAA, Invitrogen) and 50 uM β-Mercaptoethanol ...
-
bioRxiv - Cell Biology 2023Quote: ... and 1% of Non-Essential Amino Acid supplement (Gibco, 11140-050).
-
bioRxiv - Microbiology 2023Quote: ... 50 µg/ml gentamicin and 1% non-essential amino acids (Invitrogen). IEC-6 cells were supplemented with 0.1 U/mL of bovine insulin (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... MEM non-essential amino acids (0.1mM final concentration; Invitrogen, Carlsbad, CA), GlutaMax (1x final concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... BMPR2 (Cat # 4390824) and non-target (NT) controls (Cat # 4390843, Invitrogen), with 2ul of Lipofectamine RNAimax (Cat # 13778-1.5 ...
-
bioRxiv - Immunology 2023Quote: ... 0.1 mM MEM non-essential amino acids (Gibco, Cat#11140-050), 2mM L-glutamine RPMI (Multicell ...
-
bioRxiv - Microbiology 2023Quote: ... Non-specific competitive DNA is poly(dI:dC) provided by Thermo Fisher. Imaging was done by Amersham Imager 600 (Gelifesciences ...
-
bioRxiv - Biochemistry 2023Quote: ... or a control non-targeting siRNA using lipofectamine 2000 (ThermoFisher Scientific). Cells were incubated with siALDH1A1 ...
-
bioRxiv - Neuroscience 2023Quote: ... MEM Non-Essential Amino Acids Solution (100X) (Cat# 11140050, ThermoFisher Scientific), Antibiotic-Antimycotic (100X ...
-
bioRxiv - Bioengineering 2023Quote: ... 1% (vol/vol) MEM non-essential amino acids (Thermo Fisher Scientific), 1% (vol/vol ...