Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 8794 citations for IL 13 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and cytokine levels in the supernatant/PBS wash quantified using ELISA kits according to manufacturer’s instructions (murine IL-1β: Invitrogen 88-7013-22, murine IL-6: Invitrogen 88-7064-88) and a SpectraMax M2 plate reader ...
-
bioRxiv - Neuroscience 2021Quote: ... Human recombinant fibroblast growth factor (human FGF2) (10 ng/ml, Invitrogen) was added to Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 (Gibco) ...
-
bioRxiv - Immunology 2022Quote: ... Human T cells were activated with human CD3/CD28 Dynabeads (Invitrogen), at a bead:cell ratio of 2:1 and transduced using supernatant collected from Phoenix-AMPHO cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibodies used for human samples were anti-human CD31 (#17031942, Invitrogen), anti-human CD45 (#17945942 ...
-
Planarian CREB-binding protein (CBP) gene family regulates stem cell maintenance and differentiationbioRxiv - Developmental Biology 2020Quote: ... TMUS-13 and AA4.3 and Alexa 568-conjugated goat anti-rabbit diluted 1:1000 (Molecular Probes) for PH3 and SMEDWI-1 ...
-
bioRxiv - Biophysics 2019Quote: ... Blue native gradient gel was generated with a 4-13% (w/v) gradient of acrylamide (Invitrogen) 0.1 μg of DdMCU-NTD (in the absence and presence of 0.5% (w/v ...
-
bioRxiv - Bioengineering 2020Quote: ... Slices were immunolabeled using primary antibodies GFAP (1:1000 dilution, rat IgG2a, Invitrogen cat# 13-0300) to label astrocytes ...
-
bioRxiv - Microbiology 2020Quote: ... Spores were incubated with 10 μM SYTO 13 Green Fluorescent Nucleic Acid Stain (Thermo Fisher Scientific) for 2 h and observed by epifluorescence microscopy ...
-
bioRxiv - Plant Biology 2021Quote: ... 13 days old whole seedlings were harvested at zeitgeber 22 (ZT) in RNA later solution (Thermofisher) and leaf 3 blades were dissected with a razor ...
-
bioRxiv - Genetics 2022Quote: ... fixed and permeabilized eyecups were incubated with anti P-cadherin rat monoclonal antibody (13-2000Z, Invitrogen), in PBS containing 0.2% Triton-X 100 and 1% BSA at 1:500 dilution ...
-
bioRxiv - Genomics 2022Quote: ... 1:200 dilution of Anti-Mouse SSEA1 Biotinylated antibody (Thermo Fisher Scientific, Cat#: 13-8813-80), 1:200 dilution of Anti-Mouse Gr-1 APC-Cy7 antibody (Biolegend ...
-
bioRxiv - Synthetic Biology 2020Quote: ... RT-PCR products obtained from round 13 were cloned with TOPO TA Kit (Invitrogen; Carlsbad, CA) according to the manufacturer’s indications ...
-
bioRxiv - Cell Biology 2022Quote: ... Huh7 YFP-TIA1 Neo cells (13) were supplemented with 1 mg/ml G418 (Invitrogen, Life Technologies). Huh7 YFP-TIA1 Neo PKR Blr cells and Huh7 PKR Blr cells (PKROE)(13 ...
-
bioRxiv - Cell Biology 2022Quote: ... Huh7 YFP-TIA1 Neo cells (13) were supplemented with 1 mg/ml G418 (Invitrogen, Life Technologies). Huh7 YFP-TIA1 Neo PKR Blr cells and Huh7 PKR Blr cells (PKROE)(13 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were: rat anti-E-cadherin (1:500, Thermo Fisher, Cat. No. 13-1900, clone ECCD-2), goat anti-Sox2 (1:150 ...
-
bioRxiv - Microbiology 2019Quote: ... and adults after mating (13-15 days after eclosion) by using TRIzol extraction kit (Invitrogen USA). In addition ...
-
bioRxiv - Molecular Biology 2021Quote: Immortalized mesangial cells (SV40 MES 13, ATCC) were cultured in DMEM (Invitrogen Corporation, Gaithersburg, MD, USA) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2021Quote: ... on day 4 after re-stimulation with phorbol 12-myrisate 13-acetate (PMA; 10nM; Life Technologies) and ionomycin (1uM ...
-
bioRxiv - Immunology 2022Quote: ... The following primary antibodies were used: rat anti-GFAP (#13-0300, Thermo Fisher Scientific; 1:400), rabbit anti-Calbindin (#Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were seeded 24 hrs before the experiment in 13 mm sterile glass coverslips (Thermo scientific). Cells were then washed with PBS and fixed with 4% PFA for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... or siRNAs against mouse Adgrg6 (MSS278013: #13 CGACUGCCAAGGGCCUGUCAUUUAA MSS210995: #95 GCCUCCAAAUUUGCUUGAGAAUUUA; MSS210997: #97 CCGUGUUACCCUAAUGACUACCCUA, ThermoFisher Scientific). Transfection was performed using Lipofectamine 2000 (LS11668019 ...
-
bioRxiv - Plant Biology 2022Quote: ... 13 and 14 promoters were amplified with specific primers using Phusion HF polymerase (Thermo Fisher Scientific), and PCR amplicons were sequenced by Sanger sequencing (Microsynth seqlab) ...
-
bioRxiv - Neuroscience 2023Quote: ... The blocking solution was removed and incubation with GFAP primary antibody (Invitrogen #13-0300, 1:400), diluted in PBS containing 3% goat serum with 0.2% TX-100 (PBST) ...
-
bioRxiv - Bioengineering 2023Quote: ... at a concentration of 50 nM (final concentration) using Lipofectamine RNAiMAX (Cat. #13-778-150, Invitrogen) transfection reagent following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: The primary antibodies used in this study included: rat anti-Gfap (1:1000, Thermofisher, #13-0300); guinea pig anti-Gfap (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with rat anti-E-cadherin primary monoclonal antibody ECCD-2 (Invitrogen, 13-1900) diluted at 1:500 overnight at 4°C with gentle rocking ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfected cells incubated in primary antibodies: mouse anti-c-myc 9E10 (1:1000, Invitrogen# 13-2500), rabbit anti-Tyr165 (1:250 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... fixed oocytes were first incubated with a mouse monoclonal against alpha-tubulin (LifeTechnologies-Invitrogen, 13-800), followed by an incubation with chicken anti-mouse IgG conjugated to Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng/mL IL-18 (Invitrogen, cat#rcyec-hil18) or 500 U/mL IFNg (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... swinholide A (cat. 501146229, Fisher Scientific, Hanover Park, IL), blebbistatin ...
-
bioRxiv - Biophysics 2020Quote: ... An ECL detection system (Thermo Scientific, Pierce, IL, USA) was used to detect the protein signals ...
-
bioRxiv - Cancer Biology 2020Quote: ... and visualized by chemiluminescence (Thermo Fisher Scientific, Rockford, IL).
-
bioRxiv - Molecular Biology 2021Quote: ... and 0.5% glutaraldehyde (cat no. BP25481, Fisher Scientific, IL) to improve the gel adhesion ...
-
bioRxiv - Cell Biology 2022Quote: ... Supernatants were collected and subjected to IL-1β (Invitrogen) and TNF-α (R&D ...
-
bioRxiv - Cell Biology 2022Quote: ... determined by BCA protein assay (Thermo Scientific, Rockford, IL), were loaded onto SDS-PAGE gel and immunoblotted using antibodies against clathrin heavy chain (1:1,000 ...
-
bioRxiv - Immunology 2022Quote: ... and incubated with intracellular antibodies (Biolegend: IL-17A; ThermoFisher: IL-2 AF488 ...
-
bioRxiv - Microbiology 2019Quote: ... from Biolegend and IL-4-Alexa Fluor 488 (11B11) from Invitrogen. Live cells were identified using fixable live dead aqua (Life Technologies) ...
-
bioRxiv - Biophysics 2019Quote: ... An ECL detection system (Thermo Scientific, Pierce, IL, USA) was used to detect the protein signals ...
-
bioRxiv - Biochemistry 2019Quote: ... OPA reagent was purchased from Thermo Scientific (Rockford, IL). Materials used for cell culture were from Gibco by Life Technologies (Grand Island ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... by homogenizing in TRIzol (Thermo Scientific, Rockford, IL, USA) and following standard methods ...
-
bioRxiv - Bioengineering 2021Quote: ... and IL-2 using ELISA kits provided by ThermoFisher. The characterizations followed the manufacturer’s protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fluorescent probes were supplied by Molecular Probes (Rockford, IL). Insulin was measured by an ELISA kit (Mercodia ...
-
bioRxiv - Cancer Biology 2020Quote: ... An ECL detection system (Thermo Scientific, Pierce, IL, USA) was used to detect the protein signals ...
-
bioRxiv - Microbiology 2022Quote: ... PE-conjugated anti-IL-2 (Invitrogen/eBioscience Thermo Fisher), and BV421 rat anti-TNF-α (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... cleaved IL-1β antibody (Thermo Fisher Scientific, PA5-105048) 1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... PE-conjugated anti-IL-2 (Invitrogen/eBioscience Thermo Fisher), and BV421 rat anti-TNF-α (BD Biosciences ...
-
bioRxiv - Neuroscience 2021Quote: ... The antibodies used were anti-IL-1β PE (ThermoFisher), anti-GLAST APC (Milteny) ...
-
bioRxiv - Microbiology 2020Quote: ... 0.1% formic acid (Thermo Fisher Scientific, Rockford, IL, USA) before the Nano liquid chromatography coupled with mass spectrometry in tandem (LC–MS/MS ...
-
bioRxiv - Microbiology 2021Quote: ... and 5 ng/ml IL-2 (Thermo Fisher Scientific), and then resuspended with 1 ml of virus per 6 x 106 cells ...
-
bioRxiv - Bioengineering 2021Quote: ... and IL-1β (#P420B, Thermo Fisher Scientific, Waltham, MA) or β-actin (#4970 ...