Labshake search
Citations for Thermo Fisher :
1951 - 2000 of 10000+ citations for 7 METHYLIMIDAZO 1 2 B 1 2 4 TRIAZINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... cells were transfected with Lipofectamine 2000 at a 2:1 ratio (Invitrogen, Carlsbad, CA) immediately after plating cells ...
-
bioRxiv - Developmental Biology 2019Quote: ... Alexa Fluor 647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:500, A15452, ThermoFisher), rat anti-Intercellular adhesion molecule 2 (ICAM2 ...
-
bioRxiv - Neuroscience 2021Quote: ... using 1 µg of DNA and 2 µL of Lipofectamine 2000 (Thermo Fisher Scientific) per well of a 24-well plate ...
-
bioRxiv - Cell Biology 2020Quote: ... 2×106 cells were incubated with Hoechst 33342 (1 mg/mL) (Thermofisher Scientific, 62249) to stain the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µl of 1 % GFP-non-toxic fluorescent cholera toxin (Thermofisher, catalogue number C34775) was injected as described previously 36,37 into three sites in the duodenal wall ...
-
bioRxiv - Immunology 2021Quote: ... The following day 300μL of ExpiFectamine Enhancer 1 and 3mL of Enhancer 2 (Invitrogen) was added and the secreted recombinant Spike or RBD protein in culture supernatant were harvested after 72 hours and affinity purified using HisTrap HP Column (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by laminin (Thermo Fisher 23017015, 1-2hr at 37°C, 2 μL/well) overnight at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.4) and then loaded with 1 μM Fura-2 AM ester (Life Technologies) in calcium buffer for 45 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies include Anti-beta tubulin (1:500, mouse monoclonal, 2 28 33, Invitrogen), Anti-Hec1 (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1-2 times per week after dissociation with TryplE (Gibco, 12605010) or EDTA in DPBS (final concentration 0.5mM ...
-
bioRxiv - Microbiology 2021Quote: ... 2 mM l-glutamine and 50 μg ml−1 of penicillin and streptomycin (Invitrogen). Cells were incubated at 37 °C in 5% CO ...
-
bioRxiv - Immunology 2020Quote: ... Cells were stimulated 2:1 beads to cell with CD3/28 (Dynabeads, Life Technologies) for 72h then harvested ...
-
bioRxiv - Immunology 2021Quote: ... RNA samples were treated with 1 µl DNase I (2 U) (Ambion™, #AM2222) per 10 μg of total RNA in a 50 μl reaction for 30 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: 1×106 LDN or NDN were suspended in PBS-/- + 2% fetal calf serum (Gibco) and stained with CD66b ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were probed with monoclonal HA Tag antibody (1:2000 dilution, Invitrogen, 2-2.2.14,), incubated with anti-mouse IgG-horseradish peroxidase (IgG-HRP ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated 1-2 h in secondary antibodies Alexa-488 and Alexa-647 (ThermoFisher) to label GFP and Fas3 ...
-
bioRxiv - Microbiology 2022Quote: ... stained using FITC-conjugated F(ab’)2-Goat anti-human IgA (Invitrogen; 1/1000) in PBS + 0.1% BSA for 20 minutes ...
-
bioRxiv - Immunology 2022Quote: ... 1-2×104 cells were lysed in 200 µL of TRIzol (Thermo Fisher Scientific) and RNA was isolated according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg mL-1 10,000 MW FITC lysine charged dextran (ThermoFisher Scientific, Waltham, MA) and 50 ng µL-1 of Renilla Luciferase (RLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... 1-2 µg of total plasmid DNA was transfected using lipofectamine 3000 (Thermo Scientific). Cells were trypsinized and replated onto No 1.5 coverglass the following day and analyzed ∼12-16 h later by indirect immunofluorescence ...
-
bioRxiv - Neuroscience 2022Quote: ... then a fluorescent Nissl stain was applied (1:200 in 2% NDST, Thermo Fisher N21479 for MORmCh and KORtdTomato or N21483 for DORGFP and NOPYFP ...
-
bioRxiv - Immunology 2022Quote: ... then with 2 μl of 20 mg ml−1 proteinase K (Thermo Fisher Scientific) for 1 h at 55° C ...
-
bioRxiv - Immunology 2022Quote: ... Transfections were performed using with a 2:1 ratio of lipofectamine 2000 reagent (Invitrogen) to DNA.
-
bioRxiv - Microbiology 2022Quote: ... mouse anti-claudin 1 monoclonal antibody (2 µg/ml, 37-4900, Thermo Fisher Scientific); rabbit anti-claudin 3 polyclonal antibody (1:100 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... 2) Concentrate worms by centrifugation (1 minute, 4000-RPM, Thermo Scientific Sorvall Legend X1R), discard the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... 1-2 ug of RNA was converted to cDNA using reverse transcriptase (Applied Biosystems).
-
bioRxiv - Microbiology 2023Quote: ... filtered through a slow filter paper (#293; 1–2 µm Sartorius, Thermo Fisher Scientific), and then used to determine electrical conductivity (EC) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The LSC growth medium contains 2:1 Dulbecco’s Modified Eagle Medium (Life Technologies, 21969035) and F12 (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: The Caco-2/THP-1 co-cultures were washed thrice with DPBS (Gibco, #10010023) to remove any residual substances ...
-
bioRxiv - Cell Biology 2023Quote: ... After blocking for 1 hour in 2% bovine serum albumin (BSA; BP9701, Fisher Scientific) in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1-2 drops of ProLong Gold Antifade Mountant (cat# P36930, Molecular Probes, Eugene, OR) were added ...
-
bioRxiv - Immunology 2023Quote: ... Luc-Screen™ Extended-Glow Luciferase buffers 1 and 2 (ThermoFisher, Cat No. T1035) used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM TCEP (tris(2-carboxyethyl)phosphine (TCEP) and EDTA-free protease inhibitors (ThermoFisher). Cells were lysed by sonication and the cell debris pelleted at 50000 x g and 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µL 1 M DTT and 27.5 µL of T4 Polynucleotide Kinase (Thermo Scientific) were added to the annealed oligonucleotides and the reaction was incubated for 2 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The microwells were in lysis buffer (1% 2-mercaptoethanol (Fisher Scientific, cat# BP176-100), 99% Buffer TCL (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... viruses were mixed 1:2 with PBS-washed sheep blood (Fisher Scientific, MA, USA) supplemented with 5 mM ATP ...
-
bioRxiv - Physiology 2023Quote: Isolated cardiomyocytes were loaded with 1 μM Fura-2 AM (Invitrogen, Carlsbad, California, USA) at room temperature for 15 min and then washed for 15 additional min with an external Ringer solution containing (in mmol/L) ...
-
bioRxiv - Immunology 2023Quote: ... Lymphocytes were plated at 1-2 × 106 cells/mL in RPMI: RPMI 1640 (Gibco) supplemented with 15% FCS ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 h and Alexa Fluor 594-conjugated streptavidin (1:500, Thermo Scientific, S32356) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-E-cadherin (2 μg/ml, clone HECD-1; Invitrogen, Carlsbad, California, USA) and mouse anti-CX3CL1 (2 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mL of enhancer 1 and 0.15 mL of enhancer 2 (Expifectamine kit, Gibco) were added to the cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AF647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:250, A15452, Thermo Fisher).
-
bioRxiv - Biochemistry 2023Quote: ... and 1% SDS buffer and digested with 2 µL RNAse Cocktail (Thermo Fisher, AM2286) for 4 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC-1 and MIA PaCa-2 cell lines were cultured in DMEM medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:1000 dilution in 2× SSC (diluted from 20× SSC, Invitrogen, 15557-044) for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% of Horse Serum and 1% of penicillin-streptomycin (Thermo Fisher, Waltham MA, USA).
-
bioRxiv - Developmental Biology 2024Quote: ... Alexa Fluor 647 rat anti-intercellular adhesion molecule 2 (ICAM2, 1:500, A15452, ThermoFisher), rat anti-MKI67 (KI67 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then incubated in 1 mL crosslinking solution containing 2% formaldehyde (Pierce, ThermoFisher Scientific) (50mM HEPES Buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... containing 2% sodium dodecyl sulfate and 1 mM PMSF protease inhibitor (Thermo Fisher Scientific). Following a 30-minute incubation on ice with periodic vortexing ...