Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Pyrimidinergic Receptor P2Y4 P2RY4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: A synthetic DNA geneblock for the human PAC1R-null receptor sequence (PAC1R) was designed and ordered (Life Technologies) based on the NCBI protein data bank entry “NP_001109.2” ...
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... the surface receptors were labeled with 0.133 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin (Thermo scientific, 21331) in PBS at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R) (32) were maintained at 37°C in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% serum (HyClone FetalClone II ...
-
bioRxiv - Neuroscience 2019Quote: Silencing lentiviral vectors were produced by co-transfecting HEK293T producing cells with lentiviral silencing plasmids GIPZ Human histamine H3 receptor shRNA (Clone V3LHS_638095 or Clone V3LHS_638091, Thermo Scientific) with packing plasmid psPAX2 and envelope coding plasmid pMD2.G (Addgene#12260 and #12259 ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Neuroscience 2019Quote: ... a cDNA encoding this receptor was cloned into the eukaryotic expression vector pcDNA 3.1(+) (Invitrogen; Cat. No. V790-20). To facilitate expression of the cloned receptor ...
-
bioRxiv - Microbiology 2021Quote: Vero cells that stably express the canine receptor CD150 (Vero-cCD150) were grown in advanced Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% (V/V ...
-
bioRxiv - Neuroscience 2024Quote: HEK293 cells were seeded in 6-well plates and transfected with 0.25μg LgBiT-miniG (miniGs or miniGsq45) or LgBiT-β-arrestin240 and 0.25μg SmBiT-tagged receptor plasmids using 3µL Lipofectamine 2000 (Thermo Fisher). 24 hours after transfection ...
-
bioRxiv - Immunology 2022Quote: ... Dead cells were excluded using ThermoFisher LIVE/DEAD Fixable Aqua Dead Cell Stain and binding to Fc receptors was blocked using CD16/CD32 (clone 93, eBioscience/ThermoFisher). Absolute cell numbers were calculated using counting beads (123count eBeads ...
-
bioRxiv - Immunology 2019Quote: ... and cells stably expressing the receptors of interest were selected and cultured in the presence of 800 µg/ml G418 (Invitrogen). The human embryonic kidney cell line HEK293T (CRL-3216 ...
-
bioRxiv - Neuroscience 2020Quote: ... The pCAG-DCC:TDTOMATO wildtype and missense mutant receptor constructs (0.2 µg) were transfected into COS-7 cells using Lipofectamine® 2000 (Invitrogen). After 48 hours ...
-
bioRxiv - Neuroscience 2020Quote: The pCAG-DCC:TDTOMATO wildtype and missense mutant receptor constructs (0.2 µg) were transfected into COS-7 cells using Lipofectamine® 2000 (Invitrogen). After 48 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... For knockdown experiments MIN6 cells were resuspended with 25 nM antiGABA-B1 receptor or control siRNA (Dharmacon, siGENOME) pre-mixed with 1.6 μl/ml Lipofectamine RNAiMAX (Life technologies) in Opti-MEM I medium ...
-
bioRxiv - Cell Biology 2020Quote: Parent CHO-K1 and CHO-K1 cells stably expressing extracellular ACP-tagged human insulin receptors were maintained at 37°C with 5% CO2 in HAM’s F-12 medium (Thermo Fisher) supplemented 10% fetal bovine serum (FBS) ...
-
bioRxiv - Microbiology 2022Quote: ... cells and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R)(47) were maintained in DMEM containing 10% FBS (Invitrogen), 100 U/ml penicillin ...
-
bioRxiv - Molecular Biology 2020Quote: ... the receptor Fc-tagged ectodomains present in the conditioned media were captured on protein A-coated 384-plates (Thermo Scientific), and stored at 4 °C until use ...
-
bioRxiv - Immunology 2020Quote: Up to 5×106 isolated cells were incubated for 30 min at 4 °C with anti-CD16/CD32 (Fc receptor) clone 93 (Invitrogen) to block non-specific binding and with fixable viability dye eFluor455UV (eBioscience ...
-
bioRxiv - Biochemistry 2020Quote: ... , S1 subunit mutants and the extracellular domain of ACE2 receptor (GenBank NM_021804.3) were Baculovirus-free produced in High Five cells (Thermo Fisher Scientific) by transient transfection as previously described in Bleckmann et al ...
-
bioRxiv - Immunology 2020Quote: ... For neutralization assays HEK 293T expressing the SARS-CoV-2 receptor ACE2 (HEK 293T/ACE2) were cultured in DMEM (Gibco), supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: CHO cell lines overexpressing FPR2 and FPR1 receptors were generated in-house and propagated in Ham’s F12 medium (Gibco Biosciences) supplemented with 10% (v/v ...
-
bioRxiv - Physiology 2020Quote: ... βTC3 cells were transfected with plasmids encoding mouse furin and/or mouse insulin receptor (pcDNA3.1 backbone) and/or mouse Atp6ap1/Ac45-Flag using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and 20uL was added to each well of a 96 well TaqMan Array plate with chemokine/chemokine receptor primers (ThermoFisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Immunology 2021Quote: ... against Fcγ receptor RI (CD64)-FITC, FcγRIII (CD16)-PE, CD14-PerCP (Becton Dickinson, USA) and FcγRII (CD32)-ACP (Life technologies, USA) and isotype and fluorochrome matched negative control mAbs (BD ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293A cells expressing dopamine receptor sensors or other constructs were prepared on cover-glass-bottom dishes coated with 10 μg/ml of fibronectin (Gibco). Various concentration of dopamine or other ligands were added to the cells ...
-
bioRxiv - Immunology 2021Quote: The COVID-19 receptor-binding domain (RBD) and the N-terminal peptidase domain of human ACE2 were expressed using HEK293F cells (Invitrogen). The COVID-19 RBD (residues Arg319-Phe541 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells expressing either the paternal or maternal allele (or both) of the receptor studied were sorted and expanded for 1 week in RPMI 1640 (ThermoFisher) containing 200 U/mL recombinant IL-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then processed for real-time polymerase chain reaction (RT-PCR) to assess the expression of the oxytocin receptor (primers and probe assay ID: Rn00564446_g1, purchased from Life Technologies). In particular ...
-
bioRxiv - Biochemistry 2023Quote: ... 155-238) were fused to the C-termini of tagged receptors and cloned into the NheI-XhoI sites of pCEP4 (Invitrogen). Plasmids for HIV-1 MN gp160 and BaL gp160 (# 100919 ...
-
bioRxiv - Microbiology 2023Quote: ... 293T-hACE-2 (BEI resources, NIH, Catalog No. NR-52511) cells expressing the ACE2 receptors were cultured in DMEM (Gibco) supplemented with 5% FBS (Fetal Bovine Serum) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were incubated with anti-CD16/32 (FC receptor block) at 1:100 and LIVE/DEAD Fixable (1:400-1:800; cat no., 15519340; Invitrogen) in 20 μl PBS for 10 min ...
-
bioRxiv - Immunology 2023Quote: ... to block non-specific binding of fluorochrome-conjugated anti-human monoclonal antibodies to Fc receptors before being labeled with a 27-color panel of markers including the viability dye Live/Dead Blue (Invitrogen), following manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: HEK-293 cells overexpressing GluA2 or GluA2-TARPγ2 receptors were labeled with 1:4 ratio of maleimide derivatives of Alexa 555 (donor) and Alexa 647 (acceptor) fluorophores (Invitrogen) in extracellular buffer (135 mM NaCl ...
-
bioRxiv - Physiology 2023Quote: ... nearly 106 cells were first incubated on ice for 30 minutes in a solution consisting of a 1:10 Fc Receptor Binding Inhibitor (eBiosciences) and 1:500 Live/Dead Aqua stain (Invitrogen) diluted in PBS ...
-
bioRxiv - Biophysics 2024Quote: mRNA encoding the ρ1-EM GABAA receptor was produced by in-vitro transcription using the mMessage mMachine T7 Ultra transcription kit (Ambion) according to the manufacturer protocol ...
-
bioRxiv - Immunology 2019Quote: All the receptors used in this study were either cloned into bicistronic pEFIN3 vector (Euroscreen) for stable expression or pcDNA3 vector (Life Technologies) for transient expression (S1 Table) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed for receptor cDNA using validated primers (S4 Table) and SYBR Green Power PCR Mix (Applied Biosystems, ThermoFisher) on an iQ5 real-time qPCR detection system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-qPCR was performed for receptor cDNA using validated primers (S4 Table) and SYBR Green Power PCR Mix (Applied Biosystems, ThermoFisher) on an iQ5 real-time qPCR detection system (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... was added together with labelled α-bungarotoxin (to visualise post-synaptic acetylcholine receptors) in blocking solution for 1.5 h at room temperature (RT) (α-btx, Life Technologies). Then ...
-
bioRxiv - Microbiology 2020Quote: One 96-well plate was coated with 200ng/well of recombinant N protein and another plate was coated with 200ng/well of recombinant 6xHis-tagged SARS-CoV-2 spike protein receptor binding domain (RBD) produced using the FreeStyle 293 Expression System (Thermo Fisher) from BEI Resources (Cat# NR-52366 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: The assay procedure is based on the manufacturer’s protocol for LanthaScreen™ TR-FRET Thyroid Receptor beta Coactivator Assay (Invitrogen, PV4686) with slight ...
-
bioRxiv - Neuroscience 2020Quote: Cells were incubated with anti-human Fc receptor (0,005 µg/ml eBioscience, 14-9161-73) for 10 min in Medium A without phenol red (HBSS (Gibco, 14170-053) containing 15 mM HEPES (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... the P2X2 receptor was conditionally expressed into SST+ interneurons and selectively stimulated by laser uncaging of DMNPE-caged ATP (100μM, Life Technologies, UK). LSPS was performed using an ultraviolet (UV ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSOs specific to insulin receptor pre-mRNA were transfected in cells with either Lipofectamine 2000 (Catalog Number 11668030) from Life Technologies.
-
bioRxiv - Cell Biology 2021Quote: The expression cassette consisting of a Kozak sequence followed by the coding sequence for human diphtheria toxin receptor (hDTR; UniProt Q53H93) was codon-usage optimized for expression in mice and synthesized (Thermo Fisher Scientific/GeneArt ...
-
bioRxiv - Plant Biology 2023Quote: ... coding sequences of receptor and effector genes with or without stop codons were either synthesized as pDONR221 entry clones from GeneArt (Thermo Scientific), or were published previously (Saur et al. ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... SNAP-tagged human β2-adrenoceptor or human EP2 receptors fused at the C terminus to a thermostable Nanoluciferase (Hek-ssβ2-AR-tsNluc) using Lipofectamine 3000 reagent (Invitrogen, Paisley, UK). Original SNAP tag and Nanoluciferase sequences were from NEB (Hitchen UK ...
-
bioRxiv - Neuroscience 2023Quote: ... A DNA fragment containing the nucleotide sequence of the membrane-bound EGFP link via a T2A cleaving site to the TVATC66 receptor Field 69 coding sequence was designed in an inverted orientation and ordered via GeneArts (ThermoFisher Scientific). This DNA sequence was subsequently amplified by Q5 Hot Start High Fidelity DNA polymerase-based PCR (New England Bioscience ...
-
bioRxiv - Developmental Biology 2021Quote: ... 35 μm thick sections were used immunohistochemistry (IHC) of acetylcholine receptors (α-Bungarotoxin extracted from Bungarus muticinctus, conjugated to Alexa Fluor 647, Thermofisher #B35450) and nerve fibers (chicken anti-neurofilament-H antibody ...