Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for Protein Labeling kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: Lipid raft labeling was performed with Vybrant® Alexa Fluor® 594 Lipid Raft Labeling Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol with minimal modifications ...
-
bioRxiv - Neuroscience 2023Quote: TMT labeling was performed as instructed by TMT 10-plex Mass Tag Labeling Kits and Reagents (ThermoFisher, Cat# 90110). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... The dialyzed rMNs were then labeled with either Alexa Fluor 488 (Green-Fluorescent) or Alexa Fluor 647 (Red-Fluorescent) with succinimidyl ester labeling kits (ARES DNA Labeling Kit, Invitrogen, Cat A21665 and A21676). The fluorescent labelled rMN were concentrated by spin-dialysis.
-
bioRxiv - Microbiology 2021Quote: ... Protein samples were labeled with TMT10plex isobaric mass tag labeling reagents (Thermo Scientific), at a concentration of 20 μg/μL in dry acetonitrile ...
-
bioRxiv - Cell Biology 2021Quote: ... 50μg of protein was analyzed by TMT pro-16-plex labeling (Thermo Fisher), peptides fractionated by basic reverse phase (bRP ...
-
bioRxiv - Neuroscience 2020Quote: ... using the FlashTag™ Biotin HSR RNA Labeling Kit (Affymetrix) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... labeling using a 6-plex TMT kit (Thermo Fisher Scientific) and desalted ...
-
bioRxiv - Neuroscience 2022Quote: ... labeling was visualized using the Click-it EdU kit (Invitrogen). Sections then were subjected to standard immunolabeling as described below.
-
bioRxiv - Pathology 2022Quote: ... and labeling used the Affymetrix Ambion WT Expression Kit (Affymetrix) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... conjugated to Dylight 550 with a labeling kit (ThermoFisher Scientific). The cells were grown to confluence on gelatin-coated round 12-mm diameter glass coverslips (GG-12-Gelatin ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A TMT10plex™ isobaric labeling kit (0090110, Thermo Fisher Scientific) was used to label each sample per manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... using the Cytvia Amersham Megaprimer labeling kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... was conjugated to AlexaFluor647 using the Antibody Labeling Kit (ThermoFisher). The concentration decoy reagent was quantified using a NanoDrop ...
-
bioRxiv - Molecular Biology 2023Quote: Samples were labeled using a TMT10plex labeling kit (Thermo Scientific). Lyophilized ...
-
bioRxiv - Bioengineering 2023Quote: ... A Site-click Qdot 655 antibody labeling kit (Invitrogen, S10453) was used to conjugate 125 μg of Tau-5 to dibenzocyclooctyne (DIBO ...
-
bioRxiv - Systems Biology 2024Quote: ... Labeling was performed using TMTpro 16-plex kits (ThermoFisher 44520). Each batch included one TMT channel with a labeled GIS standard ...
-
bioRxiv - Immunology 2019Quote: ... The idiotype antibodies and Fc-fusion proteins were conjugated in house with Dylight488 and/or 650 antibody labeling kits (Thermo Fisher). T cell surface phenotype was assessed using the following antibodies:
-
bioRxiv - Immunology 2019Quote: ... purified Sema3A protein was labelled with AF647 using Alexa Fluor 647 Antibody Labeling Kit according to protocol (Invitrogen, cat. no A20186) at a F/P rate at 1-2.
-
bioRxiv - Neuroscience 2022Quote: ... syp-mCh and SSF-tagged opioid receptors using the lipofectamine method were incubated for 15 minutes with Alexa-647 conjugated anti-FLAG antibody (1/1000, M1 antibody from Sigma, Alexa Fluor 647 Protein Labeling Kit from Thermo Fisher) before neurons were washed 3 times with HBS and mounted on the microscope in HBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... and an equal amount of protein was used for labeling by Alexa Fluor 488 using the Click-iT HPG Alexa Fluor 488 protein synthesis assay kit (Thermo Fisher). Labeled nascent proteins were resolved on a 12% SDS gel and visualized on a ChemiDoc Imager (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... Total protein normalization has been performed by using No-Stain™ Protein Labeling Reagent (ThermoFisher Scientific, Cat.n. A44717). Images were acquired with a Chemidoc MP imaging system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... total protein loading on the PVDF membrane was stained with No-StainTM Protein Labeling reagent (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: Bromodeoxyuridine (BrdU) labeling for cell proliferation was carried out on histological sections using a Zymed BrdU Labeling and Detection Kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: For double labeling tissue with two antibodies both raised in rabbit we utilized a Zenon double labeling kit (Z25302, Invitrogen) with rabbit anti-Fnbp1l ...
-
bioRxiv - Biochemistry 2021Quote: ... and an equal amount of protein was used for labeling by Alexa Fluor 488 using the Click-iT™ HPG Alexa Fluor™ 488 Protein Synthesis Assay Kit (ThermoFisher). Labeled proteins were resolved on 12% SDS gel and visualized on a ChemiDoc Imager (BioRad) ...
-
bioRxiv - Biophysics 2021Quote: ... Purified SSNA1 was labeled using Alexa Fluor 488 and Alexa Fluor 647 Microscale Protein Labeling Kits (ThermoFisher Scientific, cat. #A30006 and #A30009) according to the manufacturer’s instructions ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: The fluorescence-labeled AFP1-His proteins were prepared according to the manufacturer’s instruction of the DyLight 550 Antibody Labeling kit (Thermo Fisher; Cat#84530). One OD600 of cells washed with MES buffer was subjected to immunostaining using the primary anti-HA antibody and AF488-conjugated secondary antibody or wheat germ agglutinin conjugated antibody (WGA-A488 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Bavi and 11.31 were used as PS-binding controls and stained with Alexa Fluor™ 594 Microscale Protein Labeling Kit (ThermoFisher, cat#A30008). Cells were washed twice with flow buffer prior to staining with BV421 Annexin V (BioLegend ...
-
Physiological activation of the nephron central command drives endogenous kidney tissue regenerationbioRxiv - Physiology 2021Quote: Global protein synthesis was assessed by O-propargyl-puromycin (OPP) labeling (Thermo Fisher Scientific) as described before (20) ...
-
bioRxiv - Neuroscience 2021Quote: ... membranes were stained with No-Stain™ protein labeling reagent (Thermo Fisher scientific #A44717) to assess a similar protein load in the samples ...
-
bioRxiv - Neuroscience 2023Quote: ... and blots were immediately stained with No-Stain™ Protein Labeling Reagent (Invitrogen, A44449) where indicated ...
-
bioRxiv - Plant Biology 2024Quote: Desthiobiotin-GTP protein labeling was conducted Pierce GTPase ActivX Probe (Thermo Scientific, catalog #88315). For each labelling reaction ...
-
bioRxiv - Genetics 2021Quote: ... membranes were hybridized at 65°C overnight with denatured probes generated by Klenow-labeling of an Arabidopsis centromere 180 bp satellite fragment with α32P dATP (DecaLabel DNA Labeling Kit, Thermo Scientific). The fragment was prepared by PCR amplification of Arabidopsis genomic DNA using the primer combination CEN-1 ATCAAGTCATATTCGACTCCA and CEN-2 CTCATGTGTATGATTGAGAT ...
-
bioRxiv - Molecular Biology 2022Quote: ... a ∼ 300 bp-long plasmid-derived fragment containing a telomeric sequence was used as a template for random labeling (DECAprime II DNA Labeling Kit, Thermo Scientific) with dATP [α-32P] (Perkin Elmer/Hartmann-Analytic) ...
-
bioRxiv - Immunology 2023Quote: ... of two mice age groups (4M and 19M) was taken in a 1.5 mL centrifuge tube for labeling experiment (TMT10plex Isobaric Mass Tag Labeling Kit, Thermo Scientific, #90113). The protein samples’ volume was adjusted with TEAB buffer (100 mM ...
-
bioRxiv - Molecular Biology 2021Quote: ... Riboprobes were labeled with a digoxigenin RNA labeling kit (Thermofisher, AM1324). Furthermore ...
-
bioRxiv - Developmental Biology 2022Quote: ... and labelled with the GeneChip WT Terminal Labeling Kit (ThermoFisher Scientific) as per manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... and terminally labeled using the GeneChip WT Terminal Labeling kit (Affymetrix) incorporating biotinylated ribonucleotides into the DNA ...
-
bioRxiv - Microbiology 2019Quote: ... using APEX antibody labeling kits as per manufacturer’s protocol (ThermoFisher Scientific). Samples were washed 3 × 5minutes with PBS/0.1% Triton X-100 ...
-
bioRxiv - Systems Biology 2021Quote: ... Cells were then stained with an EdU labeling kit (Life Technologies) and counterstained with Hoechst 33342 for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... EdU staining was performed using the EdU labeling kit (Life Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... EdU staining was performed using the EdU labeling kit (Life Technologies). Nuclei were stained using with 0.1μg/mL of DAPI dye for 15 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... one was labeled with a Zenon IgG labeling kit (ThermoFisher Scientific) using AlexaFluor fluorochromes ...
-
bioRxiv - Genomics 2023Quote: ... we used SiteClick R-PE Antibody Labeling Kit (Life Technologies S10467) to crosslink 5’ DBCO-modified 18-nt DNA oligonucleotides (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... Some antibodies were labeled with Zenon rabbit IgG labeling kits (Invitrogen) according to the manufacture’s instruction ...
-
bioRxiv - Genetics 2023Quote: ... and labeled using the North2South Biotin Random Prime Labeling Kit (ThermoFisher), with the addition of 1.5 uL Glycoblue Precipitant (ThermoFisher) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... was labeled utilizing the DyLight488 Antibody Labeling Kit (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... protein synthesis) were detected with No-Stain ™ protein labeling reagent as detailed in the manufacturer’s protocol (Invitrogen, Waltman, MA). All membranes were then blocked with 5% milk-TBST and incubated with primary and secondary antibodies as previously described [30] ...
-
bioRxiv - Neuroscience 2021Quote: ... the averaged intensities of bands measured for each mice/protein were normalized to the average intensity of the lanes with total protein of the corresponding samples using the No-Stain labeling kit (A44449, Life Technologies, Carlsbad, USA).
-
bioRxiv - Neuroscience 2019Quote: ... HPLC-purified dipeptide repeats were purchased from Pepscan and were either labelled with a single Cy5 dye at the N-terminus during synthesis or were labelled non-site-specifically in-house using Alexa488-Fluor® Protein Labeling Kit (Thermo Fisher Scientific) using published methods (94).