Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 Heptenoic acid 7 2 cyclopropyl 4 4 fluorophenyl 3 quinolinyl 3 5 dihydroxy calcium salt 1 1 3R 5S 6E since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and 1:500 dilution of DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (ThermoFisher). The brain slices were washed 3x with 1XPBS and then mounted with mounting media (Fluoro-Gel ...
-
bioRxiv - Immunology 2020Quote: ... and stained for DAPI (4′,6-diamidino-2-phenylindole) (Life Technologies, 1:1000). For each condition ...
-
bioRxiv - Cell Biology 2021Quote: ... coverslips were stained with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, 1:10,000) in 1X PBS for 5 min.
-
bioRxiv - Cell Biology 2024Quote: ... and stained with 4’,6-diamdino-2-phenylindole (DAPI) (1:500, ThermoFisher, 62248) in 1X DPBS for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... sections were counterstained using 4’,6-diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) and mounted with glycerol-gelatin aqueous slide mounting medium (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The medium was changed every 2-3 days and organoids were passaged every 2-4 weeks by dissociation with 1 ml of TrypLE Express (Life Technologies) at 37°C for 5 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA was then visualised using 1 µg ml-1 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) or 4 µM TO-PRO-3 Iodide (TOPRO ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Microbiology 2021Quote: ... CAS number: 328–42–7), 2-Ketoglutaric acid, disodium salt, dehydrate (>99%, CAS number: 305–72–6) were purchased from Acros Organics, Belgium ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Physiology 2021Quote: ... 0.5 μL of 1 mM Fluo-4 AM calcium dye (Thermo Fisher) was added to each chamber of cells before incubation on the Zeiss Exciter confocal microscope stage at 37°C in humidified 5% CO2 ...
-
bioRxiv - Bioengineering 2020Quote: ... 4’-6-diamidino-1-phenylindole (DAPI, Life Technologies) was applied at 1 μg/mL for 90 minutes to stain the nuclei and the samples were washed and mounted with AquaPoly/Mount (Polysciences) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt (DiD, catalog number: D7757) was purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Neuroscience 2022Quote: ... probenecid (1:250) and PowerLoad concentrate (1:100) (Fluo-4 Calcium Imaging Kit, Molecular Probes) in BrainPhys basal media for 30 min (37 °C ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Cancer Biology 2021Quote: ... U251 cells were treated with 4 uM CellEvent Caspase-3/7 green detection reagent (Molecular probes) prior to imaging ...
-
bioRxiv - Genetics 2020Quote: ... Colonies were passaged every 4 – 7 days using 3 – 5min incubation with 0.5mM UltraPure EDTA (Invitrogen) as required.
-
bioRxiv - Bioengineering 2021Quote: FBS free culture media with 15mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (Gibco) in DMEM/F12 supplemented with 1% P/S was used for all experiments performed in the lung on a chip devices ...
-
bioRxiv - Neuroscience 2021Quote: ... buffered with 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 1M (ThermoFisher, ref. 15630106) and coated with 20 μg/mL laminin (Sigma Aldrich ...
-
bioRxiv - Microbiology 2022Quote: ... and 15 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco, Gaithersburg, MD, USA). Cells were maintained at 37 °C in a humidified incubator with 5% CO2.
-
bioRxiv - Biophysics 2024Quote: ... HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid)) was obtained from Fisher Scientific (Pittsburg, PA). Peptides were reconstituted at 25 mg ml-1 in nuclease-free ultra pure water as per the manufacturer’s instructions and stored as aliquots at -20°.HP1α was reconstituted (0.5 mg ml-1 ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Bioengineering 2021Quote: ... Cells were loaded with culture medium containing 3 μM of the fluorescent calcium indicator Fluo-4/AM (Life Technologies) and Pluronic F-127 (0.2% w/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and the fluorescent dye 4’,6-diamidino-2-phenylindole (DAPI; 1:1,000, Molecular Probes), respectively.
-
bioRxiv - Developmental Biology 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI: nuclear counterstain; 1:1000; ThermoFisher, Waltham, MA).
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:1000) for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole) (1:106, 62248, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... and for nuclei with DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; Invitrogen; 1:500). The antigen-antibody complex was visualized using the secondary antibodies dk anti-ms Rhodamine (1:500 ...
-
bioRxiv - Microbiology 2021Quote: ... along with 1 µg/mL 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen; cat#: 62248) to stain the nuclei and Alexa Fluor 647 phalloidin at 1:100 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were stained with 1:10,000 DAPI (4’,6-diamino-2-fenilindol, Molecular Probes), mounted with Prolong Diamond Antifade Mountant (Molecular Probes ...
-
bioRxiv - Neuroscience 2019Quote: ... sections were incubated with 4’,6-diamidino-2-phenylindole (DAPI 1:20000, Fisher Scientific) for 5 minutes before being washed ...
-
bioRxiv - Neuroscience 2021Quote: ... Brain slices were incubated with 4’,6-diaminodino-2-phenylindole (DAPI, Invitrogen, 1:2000) for 10 min and washed with PBS three times before mounting onto slides ...