Labshake search
Citations for Thermo Fisher :
151 - 200 of 4324 citations for 6 HYDROXY CHRYSENE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Genomics 2020Quote: ... on the QuantStudio 6 Flex (Life Technologies). Next ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 mouse ELISA kit (ThermoFisher Scientific) and IL-1β mouse ELISA kit (ThermoFisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). Samples were analyzed using a two-step amplification and melt curves were obtained after 40 cycles ...
-
bioRxiv - Genetics 2020Quote: ... or the QuantStudio 6 Flex (Thermo Fisher). The Ct values were analyzed by the enrichment compared to input method.
-
bioRxiv - Bioengineering 2019Quote: ... Novex TBE - DNA retardation gels (6%) – (ThermoFisher) were used for the electrophoresis.
-
bioRxiv - Neuroscience 2019Quote: ... in 6-well culture plates (ThermoFisher Scientific) with 800 µL of sterile medium added below the insert (Stoppini et al. ...
-
bioRxiv - Microbiology 2019Quote: ... 6’-diamidino-2 phenylindole (DAPI) (Life Technologies), and visualized on a Nikon TiE fluorescent microscope using 60X oil immersion objective ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Neuroscience 2020Quote: ... with 6 μl of RNaseout (Life Technologies). The lysates were sequentially treated with 12.6 μl of RNase-free DNase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... QuantStudio 6/7 Pro systems (Applied Biosystems). The following primers were used ...
-
bioRxiv - Neuroscience 2019Quote: ... on a QuantStudio 6 (ThermoFisher, Waltham, MA) real-time PCR machine ...
-
bioRxiv - Microbiology 2021Quote: ... in a QuantStudio 6 thermocycler (Applied Biosystems) or in a StepOne Plus thermocycler (Applied Biosystems) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and 6 ug/mL Puromycin (Gibco #A1113803).
-
bioRxiv - Microbiology 2019Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies) at 0.1 ng/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... 12 (Fisher Scientific DF2948-47-6; RRID:AB_2884995); Mouse mAb anti-Cdc42 (BD Biosciences 610928 ...
-
bioRxiv - Cell Biology 2021Quote: ... MAN0017058 by Invitrogen (pages 5 and 6). A non-targeting sgRNA that does not recognize any sequence in the human genome was used as a negative control (Invitrogen Cat# ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 6% TBE gel (ThermoFisher Scientific, EC62655BOX), and imaged with 4200 TapeStation (Agilent ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Neuroscience 2022Quote: ... Magnesium Chloride (Fisher Scientific- 7791-18-6); Di Sodium Hydrogen O-phosphate (Fisher Scientific- 7558-79-4) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6) mounted in ProLong Diamond (ThermoFisher) and cured for 24 hours at room temperature before imaging ...
-
bioRxiv - Cell Biology 2022Quote: ... or 6 μl turbofect (ThermoFisher Scientific, R0531), and was mixed and incubated for 15 min ...
-
bioRxiv - Neuroscience 2021Quote: ... on 6-well NUNC™ plates (ThermoFisher) coated with Geltrex™ (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... using a Quantstudio 6 Flex (Applied Biosystems) system in accordance with MIQE guidelines (26) ...
-
bioRxiv - Neuroscience 2021Quote: ... in 6-well culture plates (ThermoFisher Scientific) with 800 μL of 37°C pre-heated sterile medium (MEM Eagle medium 78.8% (Gibco #11095) ...
-
bioRxiv - Genetics 2022Quote: ... or QuantStudio 6 Flex (Applied Biosystems, UK). Primers used for qRT-PCR are listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 (Invitrogen; cat. no 88-7064) and TNF-α (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2020Quote: ... 6-diamidino-phenylindole dihydrochloride (DAPI; Molecular Probes).
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 mM L-glutamine (2 mM, Gibco #31600-091 ...
-
bioRxiv - Microbiology 2021Quote: ... using 6 μ of Lipofectamine 2000 (Invitrogen). Transfected cells were infected 20 h post transfection at a MOI of 100 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-di-amidino-2-phenylindole (DAPI; Invitrogen) on a glass slide ...
-
bioRxiv - Microbiology 2021Quote: ... using a Quantstudio 6 Flex (Applied Biosystems) system in accordance with MIQE guidelines (33) ...
-
bioRxiv - Physiology 2021Quote: ... on a QuantStudio 6 instrument (Applied Biosystems) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... on a QuantStudio 6 Flex (Applied Biosystems). Mitochondrial DNA (mtDNA ...
-
bioRxiv - Microbiology 2021Quote: ... using a Quantstudio 6 Flex (Applied Biosystems) system in accordance with MIQE guidelines [54] ...
-
bioRxiv - Biochemistry 2021Quote: ... loaded into QuantStudio 6 Flex (Applied biosystems) and subjected to 20-99°C heat gradient changing at 0.025 °C/sec ...
-
bioRxiv - Microbiology 2020Quote: ... 6-wells (Thermo Scientific, cat. Nr. 10119831), 2×105 HeLa and 9×105 RAW264.7 cells ...
-
bioRxiv - Immunology 2021Quote: ... on a Quantstudio 6 (Thermo Fisher Scientific). Messenger RNA levels were normalized to the reference gene Ppib (Mm00478295_m1).
-
bioRxiv - Molecular Biology 2021Quote: ... 6 µl Turbofect transfection reagent (Thermo Fisher) and 8 µl Oligofectamine (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... IL-6 Mouse ELISA kit (ThermoFisher, USA) was used ...
-
bioRxiv - Microbiology 2020Quote: ... Pyridone 6 was purchased from Fisher Scientific. Custom synthesized siRNAs were purchased from Dharmacon ...
-
bioRxiv - Developmental Biology 2022Quote: ... using QuantStudio 6 Flex system (Applied Biosystems). GAPDH was used as an endogenous control and data analyzed with ΔΔCt method ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...