Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 6 9 Anthroyloxy stearic acid 6 as since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... IL-6 (Invitrogen, #88-7064-22), and IL-1β (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) nuclear stain ...
-
bioRxiv - Plant Biology 2023Quote: ... and QuantStudio 6 (Thermo Fisher Scientific). Gene-specific primer sets (Supplemental Table 3 ...
-
bioRxiv - Bioengineering 2023Quote: ... on a QuantStudio 6 (Applied Biosystems, QuantStudio Real-Time PCR software v.1.3) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-cytokeratin 5/6 (Invitrogen, MA191106) (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The QuantStudio 6 system (ThermoFisher Scientific) was employed for running the qRT-PCR experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... Hoescht 33342 (6 µg/mL; Invitrogen) was used to identify nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... coated 6-well plates (Nunc, Denmark).
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-phenylindole, Invitrogen) was added to the secondary antibody solution ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). BAC controls were obtained from BACPAC company ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). See Supplementary Data for primers.
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen) and mounted with FluoromountG (SouthernBiotech).
-
Short-range interactions between fibrocytes and CD8+ T cells in COPD bronchial inflammatory responsebioRxiv - Pathology 2023Quote: ... pH 6 (Fisher Scientific, Illkirch, France) at 96°C in a Pre-Treatment Module (Agilent ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). Antibodies used for immunoprecipitation were ...
-
bioRxiv - Genomics 2023Quote: ... and QuantStudio 6 FLEX machine (Thermofisher). Antibodies used for immunoprecipitation were ...
-
bioRxiv - Cell Biology 2024Quote: ... 6) glucose-free DMEM (Gibco, 11966025) for 24 hr ...
-
bioRxiv - Immunology 2024Quote: ... in 6-well plates (Thermo Scientific) at 1.5x106 cells per well for 1 h at 37°C in warm RPMI-1640 medium (GIBCO) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM magnesium chloride (Invitrogen) was added ...
-
bioRxiv - Cell Biology 2024Quote: ... IL-6 (Thermo Fisher Scientific, #P620), P16 (SCBT ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 6 mM magnesium chloride (Invitrogen) was assembled ...
-
bioRxiv - Neuroscience 2024Quote: ... and QuantStudio 6 Flex system (ThermoFisher). The cDNA amplification cycle number was determined by ∼25% of the peak fluorescence value ...
-
bioRxiv - Microbiology 2024Quote: ... a 6% DNA retardation gel (Thermofisher) was pre-run at 90 V for 5 minutes with 0.5X TBE buffer (prepared from 5X TBE buffer (Thermofisher)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dissociated cells were blocked in 6% BSA and immunolabeled with anti-α3 antibody (mouse Anti-ATP1A3 xVIF 9-G10, MA3-915, Invitrogen, Thermo Fisher scientific) for 2 hours 200 times in PBS1x containing 1%BSA or at room temperature ...
-
Mycobacteria form viable cell wall-deficient cells that are undetectable by conventional diagnosticsbioRxiv - Microbiology 2022Quote: ... Nucleic acids were stained using 2 µM SYTO 9 (S34854, Invitrogen). The plasma membrane was labelled using SynapseRed C2M (SynapseRed ...
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Neuroscience 2021Quote: ... while levels of IL-6 in supernatants were determined using IL-6 mouse ELISA kit (Thermo Scientific). Similarly ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to 6 ml liquid MSgg medium of each well of a 6-well microplate (Thermo Scientific), and then grown for additional four days ...
-
bioRxiv - Microbiology 2020Quote: ... 6 × 105 293LTV cells were seeded in a 6-well plate and transfected using Lipofectamine 2000 (Invitrogen) which was complexed with DNA plasmids driving the expression of either VSV G protein (positive control) ...
-
Incidence of an intracellular multiplication niche amongst Acinetobacter baumannii clinical isolatesbioRxiv - Microbiology 2021Quote: ... The concentration of IL-6 was quantified by ELISA (Human IL-6 ELISA Ready-SET-Go!, Thermofisher) by following the supplier’s protocol.
-
bioRxiv - Biophysics 2023Quote: 6-well plate cell proliferation – Cells were seeded into 6-well plates (Fisher Scientific, 07-200-83) 150,000 cells/well and left at ambient temperature for 20 minutes to ensure homogeneous settling ...
-
bioRxiv - Cell Biology 2023Quote: ... Coding regions were transferred into Pvha-6-GFP or Pvha-6-RFP vectors by LR reaction (Invitrogen). Constructs were bombarded into unc-119(ed3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Physiology 2024Quote: ... control siRNA or siRNA targeting ADAR1 (30 pmol per well in 6-well plate) and Lipofectamine RNAiMAX transfection reagent (9 µL; Cat. # 13778075; Thermo Fisher Scientific, Dreieich, Germany) were used to transfect the cells according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Nvsix3/6:venus was generated by subcloning the Nvsix3/6 coding sequence into pENTR/D TOPO (ThermoFisher Scientific) using published primers previously used to PCR amplify Nvsix3/6 and synthesize Nvsix3/6 mRNA 47 ...
-
bioRxiv - Microbiology 2021Quote: ... thaliana seedlings cultured in 6 ml liquid MSgg of each well of a 6-well microplate (Thermo Scientific). 8 seedlings were put in each well ...
-
bioRxiv - Microbiology 2020Quote: ... Cells in antibiotic free media (8×105/6-well) were transfected 6 hours post infection with 2μg plasmid and 6μl Lipofectamine 2000 (Invitrogen) per well diluted in Opti-MEM (Invitrogen).
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Jurkat cells and NALM-6 expressing firefly luciferase- GFP (NALM-6) were cultured in RPMI 1640 (Thermo Fisher) supplemented with 10% FBS and 100 units/mL penicillin and streptomycin ...
-
bioRxiv - Genomics 2024Quote: ... C57BL /6 wildtype keratinocytes were seeded in a 6-well plate (Thermo Scientific Nunclon TM Delta Surface; 140675) at 1.5-3 × 105 cells per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were separated by electrophoresis on a 6% bis-Acrylamide (19:1) gel that was stained overnight with 1X SYBR green I nucleic acid gel stain (Invitrogen). The gel was imaged and quantified using an AlphaImagerHP (Alpha Innotech) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Peptides were eluted along an optimized 90 min gradient from 6 to 40% Mixture B (80% ACN/0.5% formic acid) with an EASY-nLC 1,200 system (Thermo Fisher Scientific). Spray voltage was set to 2.2 kV ...
-
bioRxiv - Neuroscience 2023Quote: ... brains were washed trice with PBS for 5 min and free amines were anchored with 0.1mg/mL succinimidyl ester of 6-((Acryloyl)amino)hexanoic acid (Acryloyl-X, SE, Life Technologies) in PBS at 4°C overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... with Essential 6 medium (#A1516401; Life Technologies) containing dorsomorphin (2.5 μM ...
-
bioRxiv - Molecular Biology 2020Quote: ... Twelve-well Novex 6% Trisglycine gels (Invitrogen) were pre-run in 0.5× Tris-Borate-EDTA (TBE ...
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...