Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 200 µM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate and 1% Penicillin/Streptomycin (ThermoFisher Scientific), 1 µmol/L Glucose ...
-
bioRxiv - Genomics 2021Quote: All samples were diluted 1/200 in 2% trace metal grade nitric acid (Thermo Fisher Scientific) and analyzed by an Agilent 7800 ICP-MS for all REE concentrations (m/z ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (pH = 8.5) (ThermoFisher Scientific, Waltham, MA), 4-benzoylbenzyl-trimethylammonium chloride (PLPP ...
-
bioRxiv - Cell Biology 2022Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Cat. no. 15630-080,) and 1% penicillinstreptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1% nonessential amino acids (11140050) and 0.1 mM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific), 12 ng/mL LIF (104278 ...
-
bioRxiv - Genomics 2024Quote: ... and lacking sodium pyruvate and HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) (McCoy‘s 5A, Gibco 16600082), supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Immunology 2021Quote: ... + 2 mM Glutamax + 1x non-essential amino acids (Gibco) + 57µM β-Mercaptoethanol (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... 5,5’-dithiobis-(2-nitrobenzoic acid) (Ellman’s reagent, Life Technologies), pyridine (Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 5,5’-dithiobis (2-nitrobenzoic acid) (Thermo Scientific) prepared in 40 mM potassium phosphate buffer (pH 7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 mL of non-essential amino acids (NEAA) (Gibco), and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Microbiology 2024Quote: ... 2 mM ethylenediaminetetraacetic acid (EDTA, Fisher Scientific; cat# AM9260G), and 0.5% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: 0.63 mmole (1 equivalent) of the nucleoside-5’-monophosphate free acid (Santa Cruz Biotechnology or ACROS Organics) and 5 equivalents of 2-aminoimidazole hydrochloride (Combi-Blocks ...
-
bioRxiv - Synthetic Biology 2020Quote: 0.63 mmole (1 equivalent) of the nucleoside-5’-monophosphate free acid (Santa Cruz Biotechnology or ACROS Organics) and 5 equivalents of 2-aminoimidazole hydrochloride (Combi-Blocks ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Biochemistry 2020Quote: ... strains were negatively selected against the URA3 marker gene using 1 mg/mL of 5-Fluoroorotic Acid (5-FOA) (Fisher Scientific, F10501-5.0) in SD-plates ...
-
bioRxiv - Microbiology 2023Quote: Cell pellets were acid digested with 2 mL of Optima grade nitric acid (ThermoFisher, Waltham, MA) and 500 μL hydrogen peroxide (Sigma ...
-
bioRxiv - Microbiology 2024Quote: Cell pellets were acid digested with 2 mL of Optima grade nitric acid (ThermoFisher, Waltham, MA) and 500 μL hydrogen peroxide (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mL MEM Non-essential Amino Acids (Thermo Fisher Scientific), 1 mL 200 mM ascorbic acid (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mM 3,4-Dihydroxybenzoic acid (Fisher Scientific, Cat. No. AC114891000), 50 nM protocatechuate dioxygenase (Millipore Sigma ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 ml 100x non-essential amino acids (Gibco #11140-35), 1 mL 500x β-mercaptoethanol (5mM ...
-
bioRxiv - Neuroscience 2023Quote: ... The nucleic acid stain Hoechst 33342 (5 μM, Life Technologies) was included in the media to facilitate visualization of the nuclei ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM MEM 140 Non-Essential Amino Acids (NEAA; Gibco), 2mM Glutamax (Gibco) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 0.1mM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 1% Sodium-pyruvate (BI 03-042-1B) ...
-
bioRxiv - Biochemistry 2020Quote: ... span)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% nonessential amino acids (Gibco) and supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Invitrogen), 100 μg/mL of streptomycin (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 1% nonessential amino acids (Gibco), 2% tryptose phosphate broth (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% nonessential amino acids (Gibco), 2 mM L-glutamine and 1,000 U/mL leukaemia inhibitory factor (LIF ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1× nonessential amino acids (Gibco), 1× sodium pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% nonessential amino acids (Gibco), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... 1% nonessential amino acids (Invitrogen), 1% sodium pyruvate (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... 1% nonessential amino acids (Invitrogen), 1% sodium pyruvate (Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... nonessential amino acids (1%; Invitrogen), trace elements (1% ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% nonessential amino acids (Gibco). Tamoxifen resistant (TamR ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1× nonessential amino acids (Gibco), 0.1 mM β-mercaptoethanol (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco), 100 U/ml penicillin–100 μ/ml streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 % nonessential amino acids (GIBCO), and penicillin/streptomycin (GIBCO) ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (2◻×◻10-5 M, ThermoFisher), penicillin (100◻IU◻per ml ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... were grown in high-glucose DMEM with supplements (1% penicillin/streptomycin, 10% FBS, 1% Non-essential Amino Acids [NEAA; Wako], 55 µM 2-Mercaptoethanol [Gibco]). Mouse embryonic stem (ES ...
-
bioRxiv - Genomics 2023Quote: ... and 10 mM HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid, Gibco 15630080), and incubated at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 12 alternating fractions were resuspended in 2% formic acid/5% acetonitrile and subsequently injected for analysis on an Orbitrap Eclipse Tribrid (Thermo Fisher Scientific). For the yeast cell PISA ...