Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for Probable U3 small nucleolar RNA associated protein 11 UTP11 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Plant Biology 2020Quote: ... To detect V5-tagged proteins a 1: 5,000 dilution of the primary anti-V5 antibody (Invitrogen, #R96025) and an anti-mouse horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution ...
-
bioRxiv - Cell Biology 2020Quote: ... or anti-goat RFC1 antibody (2 μg/sample) coupled to Protein G agarose beads (Thermo Fisher Scientific) for 2 h on an end-over-end rotator at 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: 1μl Mouse anti-V5 antibody was added to every 10μl Dynabeads™ protein G (Thermo Fisher Scientific) (2.5μl per sample ...
-
bioRxiv - Genetics 2021Quote: ... Equal amounts of cell lysates were incubated with the indicated antibodies conjugated to protein G beads (Invitrogen) respectively from 4h to overnight at 4° C ...
-
Molecular coevolution of nuclear and nucleolar localization signals inside basic domain of HIV-1 TatbioRxiv - Evolutionary Biology 2021Quote: ... The antibody-bound proteins were detected using Pierce ECL western blotting substrate (Thermo Scientific, Waltham, MA, USA), and images were acquired using a Gel DocXR system (Bio-Rad ...
-
bioRxiv - Bioengineering 2021Quote: ... and probed with SARS-CoV/SARS-CoV-2 Spike Protein S2 Monoclonal Antibody (1A9) (ThermoFisher # MA5-35946) and donkey anti-mouse secondary antibodies tagged with an infrared fluorophore (Rockland Immunochemicals) ...
-
bioRxiv - Biochemistry 2021Quote: ... Antibody-bound complexes were immunoprecipitated with Novex DYNAL Dynabeads Protein G (Invitrogen, cat. no. 10-003-D) or protein A/G agarose beads (EMD Millipore ...
-
bioRxiv - Neuroscience 2021Quote: ... The antibody-HTT complexes were precipitated with protein G covalently conjugated to magnetic beads (Thermo Scientific, P188803). The HTT-depleted lysates were seeded with 10 ng of sonicated HTTex1 fibrils for 4 hr at 25°C with rotation ...
-
bioRxiv - Microbiology 2020Quote: ... and 40 µg of antibody was bound to 3 mg of protein G Dynabeads (Thermo Fisher Scientific) in 400 µL of PBS buffer containing 0.2% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... was covalently coupled to magnetic beads at 12 μg antibody per 100 μL Dynabeads Protein A (ThermoFisher). Around 1500 μg of cell lysate and 10 μg of antibody was used per sample ...
-
bioRxiv - Genomics 2022Quote: ... The antibody was added to 5μg of sonicated chromatin along with Dynabeads Protein G magnetic beads (Invitrogen) and incubated at 4°C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... The total protein level was detected by primary anti-His-tag antibody (1:10000, MA1-21315, Invitrogen) and secondary anti-mouse antibodies (1:5000 ...
-
bioRxiv - Systems Biology 2022Quote: ... Antibody/chromatin complexes were captured with ChIP-grade protein A/G magnetic beads (Thermo Fisher, cat # 26162) for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and the antibodies were purified using NAb protein A plus spin kit (Thermo Fisher Scientific, Cat# 89948) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... Myelin detection was done with antibodies against myelin basic protein (MBP; rabbit, 1:4000; Invitrogen, RRID: AB_1501419) and proteolipid protein (PLP ...
-
bioRxiv - Microbiology 2020Quote: ... IP’s were performed using 15 μg of each antibody with 50 μL Protein G Dynabeads (ThermoFisher Scientific), for 8 hours at 4°C on rotation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Chromatin bound to the antibody was then immunoprecipitated using 25ul of protein A Dynabeads (Thermo Scientific; 10002D) for 2h with rotation at 4 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... The protein-antibody-sepharose mixture was then washed 5 times in Pierce IP lysis buffer (ThermoFisher Scientific) and resuspended in 2X Laemmli sample buffer (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... The His-tagged proteins were blotted using anti-6x His tag HRP-conjugated monoclonal antibody (Invitrogen, USA) and detected using Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... The supernatant was incubated with anti-GFP antibody (5 μg/ml) prebound to Dynabeads Protein A (Invitrogen) for 2h with end-over-end rotation to capture GFP-fused L10a subunit of the 60S ribosome ...
-
bioRxiv - Biochemistry 2020Quote: ... The expression of the recombinant protein was measured by ELISA using anti‐His tag monoclonal antibody (Invitrogen) to capture and biotinylated anti‐ANG1 antibody for detection (R&D System) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... followed by binding of antigen antibody complexes to protein A/G magnetic beads (Thermo scientific, Rockford, USA) for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... and transferrin using the High Select Top 14 Abundant Protein Depletion Camel Antibody Resin (Thermo Fisher Scientific). On the day of depletion ...
-
bioRxiv - Molecular Biology 2021Quote: Polyclonal antibodies used in IPs (α-Med17, α-Med3) were conjugated to Protein G Dynabeads (Life Technologies) in batch as follows ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant proteins and antibody 47D11 were expressed transiently in FreeStyle™ 293-F Cells (Thermo Fisher Scientific) and affinity purified from the culture supernatant by protein-A sepharose beads (GE Healthcare ...
-
bioRxiv - Microbiology 2023Quote: ... before being incubated overnight at 4 degrees C with the antibodies bound to Protein A Dynabeads (Invitrogen). Samples were washed for 3 minutes each at 4 degrees C with low salt wash (0.01% SDS ...
-
bioRxiv - Immunology 2023Quote: ... Hexahistidine-tagged proteins were then detected using mouse anti-6xHis tag antibody (Ma1-135, Invitrogen, Karlsruhe, Germany) as primary antibody and signals revealed by horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (ab6789 ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-SARS-CoV-2 spike protein (RBD) polyclonal antibody (Thermo Fisher Scientific; catalog # PA5-114451).
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μg of the respective antibodies were bound to 100 μL of Protein A magnetic beads (ThermoFisher). Beads were blocked with three 1 mL washes of 5 mg/mL BSA in PBS ...
-
bioRxiv - Biophysics 2022Quote: ... Protein bands were visualized through horseradish peroxidase (HRP) conjugated secondary antibody by ECL reagent (34577, ThermoFisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... The antibody-chromatin complex was then captured with a mix of protein A and G Dynabeads (Invitrogen) for 2 hours at 4°C ...
-
bioRxiv - Microbiology 2024Quote: ... Tight junction and control proteins were detected using antibodies for ZO-1 (catalog number 339100, ThermoFisher Scientific), GAPDH (catalog number 2118 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Antibody detection of the proteins was performed using the iBind Automated Western System (Thermo Fisher Scientific Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and the antibodies were purified using NAb protein A plus spin kit (Thermo Fisher Scientific, Cat# 89948) according to the manufacturer’s protocol.
-
bioRxiv - Biophysics 2022Quote: ... The coverslips were stained with the following antibodies: rabbit anti-spike protein (Invitrogen; cat. 703959; 1:500) and mouse anti-dsRNA (J2 ...
-
bioRxiv - Microbiology 2023Quote: DB1 antibody was purified by binding clarified cell supernatant to Protein A Agarose beads (Thermo Fisher Scientific), with elution into 100 mM glycine pH 3.0 and was quickly neutralised with 1 M Tris-HCl pH 8.0 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cleared lysates were incubated with anti-IGF2BP1 or anti-AGO2 antibody and Protein G Dynabeads (Life Technologies) for 30 min at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: Immunoprecipitation experiments were performed using various antibodies coupled with the Dynabeads Protein G system (Thermo Fisher 10004D), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and anti-glial fibrillary acidic protein (GFAP) antibody (rat IgG2a, 1:250, Invitrogen, #13-0300, Carlsbad, CA). The next day ...
-
bioRxiv - Biochemistry 2024Quote: ... Detection of protein-antibody complexes was performed using an enhanced chemiluminescence substrate (Thermo Fisher Scientific, USA, #32209) and digitally imaged with Azure 280 chemiluminescence detection system (Azure Biosystems ...
-
bioRxiv - Cancer Biology 2024Quote: ... The antibodies were labeled using an Alexa Fluor 488 (Alexa 488) Protein Labeling Kit from Thermo Fisher Scientific (A10235 ...
-
bioRxiv - Cell Biology 2024Quote: ... Immunocomplexes in the antibody-lysate solutions were concentrated onto Pierce Protein A/G magnetic beads (Thermo Fisher) by incubating for 30 minutes at 4°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... Pre-warmed coating solution composed of 0.1 mg/ml FITC-gelatin (#G-13187, Invitrogen) and 10 μg/ml laminin (#23017-015 ...
-
bioRxiv - Biophysics 2020Quote: ... were incubated for 2h together with phalloidin-FITC (Molecular Probes Inc, Eugene, OR, USA). Coverslips were mounted on microscopy slides and visualized with a HC PL APO 63x/1.40 Oil CS objective lens attached to a Leica TCS-SP5 II confocal microscope (Leica Microsystems ...
-
bioRxiv - Biochemistry 2020Quote: ... Wells without FITC-rhPRG4 were probed with anti PRG4 Ab LPN (1:500, Invitrogen) in blocking solution overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated with streptavidin fluorescein (FITC) conjugated (1:400) (Thermo Fisher Scientific, Canada) on a shaker at 4°C for 12 hours ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... FITC conjugated F(ab’)2 goat anti-human IgA (Thermo Fisher Scientific, Illkirch, France), Brilliant Violet 650 conjugated streptavidin (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... then analyzed for viability using the FITC Annexin V Apoptosis Detection Kit (Thermo Scientific). Briefly ...