Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for Mouse Anti Human Immunodeficiency Virus HIV 1 p17 1981 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Anti-human TIGIT PE Cy 7 (1:50, clone MBSA43, Invitrogen, cat # 25-9500-42), Anti-human CD94 APC (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... was obtained from Abcam (Cat.# ab9498) (Cambridge, MA, USA) and anti-human ZO-1 antibody was obtained from Invitrogen / ThermoFisher (Carlsbad ...
-
bioRxiv - Cell Biology 2021Quote: ... Bound B2-IgG was stained with goat anti-human IgG-Alexa 568 (1:1,000; Invitrogen) for 30 min and analyzed by FACS ...
-
bioRxiv - Microbiology 2020Quote: ... After staining with FITC-conjugated goat anti-human IgG antibody (1:500; Thermo Fisher Scientific), the cells were analyzed by flow cytometer (BD LSRFortessa™ ...
-
bioRxiv - Neuroscience 2021Quote: ... and the secondary antibody Alexa Fluor® 633 goat anti-human IgG (1:2000, Invitrogen). Floating slices were rinsed 3×10 min with TBS and blocked with blocking buffer (10% NGS with 0.3% Triton X-100 in TBS ...
-
bioRxiv - Immunology 2021Quote: ... Anti-human Amphiregulin PE Cy 7 (1:25, clone AREG559, Invitrogen, cat # 25-5370-42), Anti-mouse Nur77 APC (1:25 ...
-
bioRxiv - Microbiology 2022Quote: ... 1:500 dilution) (goat anti-human IgG Fc Alexa 488 conjugated, Thermo Fisher, Cat #: H10120) (goat anti-human IgG (H + L ...
-
bioRxiv - Bioengineering 2022Quote: ... at a dilution 1:2000 and rabbit anti-OCN antibody (Reactivity: human, Invitrogen, PA5-96529) at a dilution 1:100 in 1% BSA in PBS-T for 1h00 at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed in PBS and incubated with anti-human Alexa-647 (1:500, ThermoFisher), and Hoechst 33342 (1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Alexa Fluor 488 goat anti-human IgG (H+L) (Invitrogen, cat # A11013, 1:1000).
-
bioRxiv - Immunology 2023Quote: ... and stained with a mouse serum that recognizes A27 (1:200 dilution) followed by adding anti-mouse AF488 (Invitrogen, A55058, 1:1000) as secondary antibody ...
-
bioRxiv - Cell Biology 2021Quote: ... cover slips were incubated for 1 h at room temperature with mouse anti-mouse Keratin 14 (LL02, Thermo Fisher, MA5-11599, 1:100 – 1:10), rabbit anti-mouse Keratin 5 (BioLegend ...
-
bioRxiv - Microbiology 2021Quote: ... HIV cDNA was amplified with TaqMan gene expression master mix (Applied Biosystems, 4369016), J1 FWD (late RT F)— ACAAGCTAGTACCAGTTGAGCCAGATAAG ...
-
bioRxiv - Microbiology 2021Quote: ... phCMV-VSVG and HIV gag-pol in the presence of Turbofect (Life Technologies) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR analysis of intracellular HIV-1 RNA was performed using PowerUp SYBR Green Master Mix (Applied Biosystems, Foster City, CA). Primer sequences used for the detection of HIV-1-RNA and β-actin gene are listed in table S2 ...
-
bioRxiv - Microbiology 2021Quote: ... HIV-1-infected primary CD4+ T cells were stained with AquaVivid viability dye and cell proliferation dye eFluor670 (Thermo Fisher Scientific) and used as target cells ...
-
bioRxiv - Microbiology 2020Quote: ... to quantify total and integrated HIV-1 DNA was performed as described previously (48) using TaqMan™ Universal PCR Master Mix (ThermoFisher). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... Drug resistance testing spanning protease (PR) and reverse transcriptase (RT) had been performed using Sanger Sequencing with the Applied Biosystems HIV-1 Genotyping Kit (ThermoFisher Scientific). We obtained the most recently generated residual nested-PCR amplicons tested and since amplicon volumes were limited ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-V5 (Invitrogen) 1:5,000 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Por1 (Invitrogen), and rabbit anti-Sec61 (generous gift from Martin Spiess ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Pgk1 (Invitrogen), mouse anti-Por1 (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-mouse (Invitrogen 35518) were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... mouse anti-GFP (Invitrogen) and anti-HA (Biolegend) ...
-
bioRxiv - Cancer Biology 2019Quote: ... AF594-anti-mouse (Invitrogen). Small molecular compounds such as 2-BP (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-V5 (Invitrogen), STAM (ProteinTech) ...
-
bioRxiv - Neuroscience 2021Quote: ... mouse anti-CD79a (ThermoFisher); mouse anti-CD4 (AbD Serotec) ...
-
bioRxiv - Microbiology 2021Quote: ... Donkey anti-mouse (Invitrogen) and Donkey anti-rat (Invitrogen).
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-RetP1 (ThermoFisher) (1:100) ...
-
bioRxiv - Cell Biology 2022Quote: ... Mouse anti-Prdx5 (Invitrogen), rabbit anti-hnRNPK (CST) ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-mouse (Thermo Scientific) or by HRP-conjugated secondaries (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: ... anti-Mouse IgG (Invitrogen) was used as isotype control ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-mouse (A11017; Invitrogen), Alexa Fluor 488 goat ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-mouse Alexa488 (Invitrogen) and anti-rabbit CY3 (Dianova)-conjugated secondary antibodies were diluted 1:600 ...
-
bioRxiv - Immunology 2020Quote: ... then anti-mouse (Invitrogen) or anti-human (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-mouse IgG2a (ThermoFisher)] diluted 1:1000 for 1hr at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... mouse anti-GAPDH (Invitrogen)] ...
-
bioRxiv - Neuroscience 2023Quote: ... mouse anti-H3K4me3 (Invitrogen). Secondary antibodies were purchased from Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... mouse anti-GFP (Invitrogen) 1/50 ...
-
bioRxiv - Microbiology 2021Quote: ... Ten-fold serial dilutions (1×10−1 to 1×10−6) of virus stocks were prepared in MEM (supplemented with 25 mM HEPES (Gibco), 2mM L-Glutamine (Gibco) ...
-
bioRxiv - Neuroscience 2021Quote: ... and goat anti-mouse Alexa Fluor 568 (1:500; Invitrogen A-11004). Expression was quantified in 3 hippocampal sections from 3 injected mice (n = 9) ...
-
bioRxiv - Genomics 2021Quote: ... or Fluor 568 conjugated donkey anti-mouse (1:100, Invitrogen, cat.no. A10037), in the dark for 1 hr at 4°C ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse monoclonal anti-yeast PGK (22C5D8, Thermo Fisher Scientific, 4592250, 1:3000), goat anti mouse IgG-Alexa 680 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-mouse IgG (H+L) coupled to AlexaFluor594 (1/200; Thermo Fisher Scientific Cat# A-21203 ...
-
bioRxiv - Cell Biology 2020Quote: ... or Alexa Fluor 594 goat anti-mouse (1 µg/ml, Invitrogen #A10239).
-
bioRxiv - Cell Biology 2019Quote: ... and mouse anti-Clathrin Heavy Chain (1:500, Thermo Fisher, clone X22). Before fixation ...
-
bioRxiv - Cell Biology 2020Quote: HRP-conjugated goat anti–mouse (1:5,000; G-21040; Thermo Fisher Scientific)
-
bioRxiv - Immunology 2021Quote: ... Secondary antibodies used: goat anti-mouse Alexa Fluor 568 (1:500; Invitrogen), goat anti-rabbit 488 (1:500 ...
-
bioRxiv - Genetics 2020Quote: ... and a mouse anti-luciferase (1:100; 35-6700, Thermo Fisher Scientific) antibodies followed by AlexaFluor 488 anti-rabbit and AlexaFluor 568 anti-mouse secondary antibodies (Both at 1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and Alexa Fluor 647 donkey-anti-mouse (1:200) (all Life Technologies). Larvae at stage L3 were dissected as previously described (Collins & Mandigo et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... Secondary antibodies: donkey anti-mouse Alexa-Fluor 488 IgG (1:2000, Invitrogen), donkey anti-mouse Alexa-Fluor 568 IgG (1:2000 ...