Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 3690 citations for CdSeTe ZnS Quantum Dots NIR region Water solvent 760nm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... supplemented with 1.4 μL of 7.5X SYBR Green in DNase/RNase free water (ThermoFisher) and 0.25 μL each of forward and reverse primers from a 10 μM stock (designed to amplify the highly conserved region of pfCRT ...
-
CRISPR-based environmental biosurveillance assisted via artificial intelligence design of guide-RNAsbioRxiv - Molecular Biology 2024Quote: ... The mastermix composition is as follows: 5.18 µL of RNase-free water (Invitrogen, #10977015), 4 µL of 5X optimized Cas13a reaction buffer (see Supplemental Table 6 ...
-
bioRxiv - Microbiology 2024Quote: ... The total volume was adjusted to 50 μl using nuclease-free water (Ambion, USA), followed by pre-denaturation at 95°C for 2 min ...
-
bioRxiv - Microbiology 2024Quote: ... then once with demineralised water and mounted with Fluoromount-G™ Mounting Medium (Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... The extracted RNA was diluted in 30 μL RNase-free water (Invitrogen™, #10977035). For each fraction ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was dried and eventually resuspended in 50 uL of DEPC-treated water (Invitrogen). A DNA-free (™ ...
-
bioRxiv - Immunology 2024Quote: ... They were then air-dried before and eluted using molecular biology grade water (Ambion) for 10 minutes at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... Waters) at 40 °C by the Vanquish UHPLC system (ThermoFisher Scientific GmbH, Bremen, Germany) coupled to a triple quadrupole mass spectrometer (TSQ Altis ...
-
bioRxiv - Bioengineering 2024Quote: ... PBS was purchased from Thermo Fisher Scientific and endotoxin-free water was used for in vivo experiments (Thermo Fisher Scientific). Trazimera (Pfizer ...
-
bioRxiv - Biophysics 2024Quote: ... The lyophilized poly-rA was dissolved into nuclease-free water (AM9937, Thermo Fisher Scientific) to be the concentration of ∼10.0 g/L ...
-
bioRxiv - Genomics 2024Quote: ... the slides were washed with 1 mL of Nuclease Free Water (ThermoFisher Scientific, 10977023) 3 times and air dried ...
-
bioRxiv - Cancer Biology 2024Quote: ... Water samples were immediately probed post-irradiation with Amplex Red assay kit (Thermo Fisher). Fluorescence quantification was performed using Promega Glo-Max plate reader (Excitation ...
-
bioRxiv - Cell Biology 2024Quote: ... 250 ng of sample protein extract and nuclease-free water (Ambion, Invitrogen TM, US) was added to bring a total volume of 25 μL reaction then loaded into MicroAmp Optical 96 well plate (Applied BiosystemsTM ...
-
bioRxiv - Cell Biology 2024Quote: ... 250 ng of sample protein extract and nuclease-free water (Ambion, Invitrogen TM, US) was added to bring a total volume of 25 μL reaction then loaded into MicroAmp Optical 96 well plate (Applied BiosystemsTM ...
-
bioRxiv - Cancer Biology 2024Quote: hMO lysates were diluted in water and denatured in 4x Laemmli buffer (ThermoFisher Scientific) with β-mercaptoethanol (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA was resuspended in 10µl of ultrapure water and digested with 2U TurboDNase (Invitrogen) in 30µl for 30min at 37°C according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were sorted directly into 20 μL LC-MS grade water (Fisher Scientific, USA). The cells were lysed after being subjected to three freezing and heating cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... isolated gDNA was diluted with water and Fast SYBR Green Master Mix (ThermoFisher, 4385614) and barcode primers were designed to amplify only one barcode sequence among the 100 unique barcodes in the entire library ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nucleic acid was re-suspended in 0.2 μm-filtered RNase-free water (Ambion; AM9937) and treated with DNase I (New England BioLabs ...
-
bioRxiv - Genetics 2024Quote: ... reconstituted in 50 µL of Optima LC/MS grade water (Fisher Scientific, Waltham, MA), sonicated for 2 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by 5 washes in pure water (Optima LC/MS Grade, Fisher Scientific, W6500), before being finally resuspended in 1µl of water and transferred to individual wells of a 384 well plate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... was obtained by inserting the sequence encompassing the LTR and the Psi region from pSDY (82) in the pJET plasmid with the CloneJET PCR Cloning Kit (Thermo Scientific, MA, USA); the second ...
-
bioRxiv - Cell Biology 2021Quote: ... Depletion of the targeted DNA region was confirmed by isolating the amplified DNA of the PCR product using the PureLink Quick Gel Extraction Kit (Thermo Fisher Scientific, K210012) and Sanger sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... oligonucleotides from homologous regions D-ORF5 5′CCGctgagCAAGGTAGCCTCGTCTATTGGAC 3′ and R-ORF7 5′CCGctcgagTTCTTCATCTTCAATATTATGTC3′ were used using the PCR Reagent System Kit (Invitrogen, Life Technologies Inc.). The reaction mixture was prepared with l00 ng of recombinant TnGV DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... we extracted the total RNA of each region of interest dissected from each brain slice using RNAqueous®-Micro Total RNA Isolation Kit (Thermo Fisher Scientific) and eluted RNA in 20 µl solution ...
-
bioRxiv - Cancer Biology 2022Quote: ... coding region was subcloned into the lentiviral vector pLX303 by Gateway cloning using Gateway LR Clonase II Enzyme Mix (Invitrogen, Cat. #11791-020) according to manufacturer’s protocol yielding plasmid pLX303-4F2-blast ...
-
bioRxiv - Immunology 2021Quote: ... PCR amplification of the region of gDNA containing the CRISPR editing locus was performed using the SequalPrep Long PCR Kit with dNTPs (Invitrogen, Cat no. A10498) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... a 1.0 kb fragment of its native terminator region and a 1.2 kb fragment after the terminator region (namely, the 3’ homologous arm) were amplified by PCR and then cloned into the pUC19 plasmid (Thermo Fisher Scientific, USA) in the order of the 5’ homologous arm ...
-
bioRxiv - Neuroscience 2021Quote: ... One-half of the powder from the cortical region was homogenized in 1000 μl Tissue Protein Extraction Reagent (TPER) per 150mg and 150μl TPER for hippocampal region (Life Technologies, Grand Island, NY), respectively ...
-
bioRxiv - Cell Biology 2020Quote: ... The siRNA-resistant form of RAB10 was generated by introducing 3 silent mutations into the target sequence of the seed region of the RAB10-siRNA (Ambion, Thermo Fisher, ID s21391), altering the original sequence by site-directed mutagenesis (QuickChange ...
-
bioRxiv - Neuroscience 2022Quote: ... randomly oriented 10 μm-thick sections were cut from the middle region of each PG using a Microm HM 325 microtome (Thermo Fisher Scientific Inc.). For antigen retrieval ...
-
bioRxiv - Genetics 2024Quote: ... followed by the addition of 300 ng of predesigned sgRNA targeting exon 3 region of the XPC gene with a crRNA sequence (5’AGGCACACCATCTGAAGAGA3’) (Thermofisher Scientific, Massachusetts, USA). The sgRNA and Cas9 mixture was incubated for 10 minutes at room temperature to assemble and form the ribonucleoprotein complex ...
-
bioRxiv - Neuroscience 2024Quote: ... Biotin-GCO AGC TOG ATO TTG OGC OC (O = C-phosphorthioate) directed against a unique region of the rat mRNA was synthesized by Invitrogen (Waltham, MA, USA). The corresponding GenBank accession number and ODN position within the mRNA sequence are NM_017171.2 and 420-439 ...
-
bioRxiv - Biochemistry 2023Quote: α-synuclein was quantified in the striatum region of mouse brain utilizing the Enzyme-linked Immunosorbent Assay (ELISA) Kit from Invitrogen (Cat No. KHB0061) following the manufacturer‘s instructions.
-
bioRxiv - Microbiology 2023Quote: ... An 800 bp fragment covering the ORF10 region was amplified by one-step RT-PCR using the SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThermoFisher) and the following primers (OL11F ...
-
bioRxiv - Molecular Biology 2023Quote: The Aire exons 6 and 8 that were the targeted genomic regions were amplified through conventional PCR using PlatinumTM high fidelity Taq polymerase (Thermo Fisher, Cat # 11304011) and the oligonucleotide primers as mentioned above.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Every gel included two molecular-weight markers for separate regions of interest (High Range Color-Coded Prestained Protein Marker; Cell Signaling Technology; and Novex Prestained Protein Standard, Thermo Fisher) on opposite ends of the gel ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Every gel included two molecular-weight markers for separate regions of interest (High Range Color-Coded Prestained Protein Marker; Cell Signaling Technology; and Novex Prestained Protein Standard, Thermo Fisher) on opposite ends of the gel ...
-
bioRxiv - Molecular Biology 2024Quote: U2OS Tet-R and K294A cells were transfected with Pre-validated Silencer Select siRNA targeting the coding region of XRN1 (Ambion, assay ID: s29016) at a final concentration of 10 nM ...
-
bioRxiv - Systems Biology 2024Quote: ... Primers to amplify the bacterial 16S rRNA gene region were barcoded to label each sample and PCR reactions were carried out in triplicate using Accuprime (Invitrogen, Carlsbad, CA, USA). Each reaction contained 5ul of extracted DNA and 0.4uM of each primer 50 nanograms of DNA and 10 pM of each primer ...
-
bioRxiv - Bioengineering 2024Quote: ... The libraries are pooled and to ensure optimal size the 140bp to 300bp region is size selected on an 8% TBE gel (Invitrogen by Life Technologies, Ref# EC6215). The size selected library is quantified with High Sensitivity DNA 1000 Screen Tape (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... Z-stack fluorescent images in the RFP channel were taken for tumor analysis of the yolk sac region at 10 X magnification using Evos FL auto fluorescence microscope (Life Technologies, Thermofischer scientific). Images were taken at 24- and 96-hpi.
-
bioRxiv - Developmental Biology 2024Quote: ... The cut yolk sac-like regions are transferred into a tissue culture-treated dish containing Essential 6™ Medium (E6, Gibco, cat #A1516401) with 1% Geltrex ...
-
bioRxiv - Physiology 2021Quote: ... no glucose), penicillin/streptomycin (15070–063), and fetal bovine serum (12306C: qualified, heat-inactivated, USDA-approved regions) were from Life Technologies (Carlsbad, CA, USA). Dextrose (D14–500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA was normalized to 10 ng/µl and twenty cycle target region PCR was performed on 50 ng of genomic DNA with Phusion™ Flash 2x master mix (Thermo Scientific, Waltham, MA) as per the manufacture’s recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... we cloned genomic sequences spanning a region from intron 8 to 10 of the RPGR gene into the mammalian expression vector pcDNA3 (Life Technologies, Carlsbad, CA, USA). RPGR wild-type minigene construct was generated (Figure 2A ...
-
bioRxiv - Biochemistry 2021Quote: ... Antibody Heavy and Light Chain variable regions were cloned from positive wells by PCR using Collibri™ Stranded RNA Library Prep Kit for Illumina™ Systems (Thermo Fisher, SG) and whole human IgG reconstructed as described previously (42) ...
-
bioRxiv - Plant Biology 2021Quote: ... the 1.5 kb upstream regions were recombined first in pDONR™207 vector and subcloned into pMDC111 destination vector (Invitrogen; (Karimi et al., 2002)) for PRX69 promoter region and into pGWB4 vector (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The regions of interest in the genomic DNA were amplified by PCR using Platinum™ Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, 11304011). Exons 10 and 21 of PIK3CA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... no glucose), penicillin/streptomycin (15070–063), and fetal bovine serum (12306C: qualified, heat inactivated, USDA-approved regions) were from Life Technologies (Carlsbad, CA, USA). Dextrose (D14–500 ...