Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 10000+ citations for 6 METHOXY 1 2 3 4 TETRAHYDRO NAPHTHALENE 2 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... cells were rinsed (3 times) with 2 ml incubation buffer and resuspended with anti-mouse Alexa Fluor 647 secondary antibody (1:2000, Invitrogen, Carlsbad, CA, USA) for 60 minutes at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... HaCaT cell transfection with a 75 pM siRNA mix (#2316-1, #2316-2, and #2316-3) was conducted using Lipofectamine RNAiMAX transfection reagent (Invitrogen, Carlsbad, CA, USA), following the manufacturer’s guidelines.
-
bioRxiv - Neuroscience 2023Quote: ... Sections were washed with cold 1× PBS-T for 3 times each for 10 min then incubated for 2 hours at RT with secondary antibodies (AF546-Ms: Invitrogen A11003, 1:500) diluted in 1× PBS-T ...
-
bioRxiv - Neuroscience 2024Quote: ... in 1X PBS-0.3% Triton X-100 (0.3% PBST) before 2-3 day incubation with primary antibodies at 4C for PCP4 (1:250, Invitrogen Cat# PA5-52209, RRID:AB_2645298) or NECAB2 (1:250 ...
-
bioRxiv - Cell Biology 2024Quote: ... The Triton-X permeabilization solution was removed and cells were washed 3×2 minutes with DPBS at RT before a blocking solution (1% BSA (Fisher Scientific, BP1600-100) was added to cells for one hour at RT with rocking ...
-
bioRxiv - Plant Biology 2020Quote: Lines with defective stomatal responses to at least one stimulus were subjected to sequencing of “usual suspects” either by NGS-based sequencing of PCR amplicons obtained with the use of gene-specific primers (Supplementary Data Set 2) and Phusion DNA polymerase (ThermoFisher Scientific; ROUND 1 to 6), or whole-genome sequencing (ROUND 7 and 8) ...
-
bioRxiv - Cell Biology 2021Quote: ... THP-1 cells (1.5×105 cells/mL) were labeled with a fluorescent dye 2’,7’-bis(carboxyethyl)-5 (6)-carboxyfluorescein-AM (Thermo Fisher Scientific B1150; 1 mg/mL) in serum-free RPMI medium (Thermo Fisher Scientific 11875093 ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were washed three times in PBS and incubated in secondary antibody (2 mg/mL Alexa Fluor 488, Invitrogen, 1:1500, 2 mg/mL Alexa Fluor 594, Invitrogen, 1:1500 ...
-
bioRxiv - Immunology 2022Quote: ... ∼50% of total lung was placed in a bead homogenizer tube with 1 mL of PBS with 2% FBS and 2% antibiotics/antimycotics (Gibco) and stored at -80°C ...
-
bioRxiv - Microbiology 2021Quote: ... The gland/crypt-containing supernatant was washed by centrifugation at 400 x g for 2 minutes and the glands/crypts re-suspended in 1-2 ml advanced DMEM/F12 (12634-010; Gibco) containing 1X B27 supplement minus vitamin A (12587-010 ...
-
bioRxiv - Cancer Biology 2021Quote: ... were cultured in EBM-2 Basal Medium supplemented with EGM-2 MV Microvascular Endothelial Cell Growth Medium and 1% v/v Pen-Strep (ThermoFisher) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: The monoclonal antibodies SARS-CoV-1/SARS-CoV-2 Spike Protein S2 (1A9) and SARS-CoV-1/SARS-CoV-2 Nucleocapsid (6H3) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... NPCs were plated on Geltrex in a 6 well plate in StemPro NSC SFM supplemented with 20ng/ml of EGF and bFGF for 2 days before switching to astrocyte differentiation medium consisting of DMEM with 1% N-2 supplement (Gibco), 1% GlutaMAX-I supplement (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... was diluted 1:1 with PBS (GE lifescience) with the addition of 2% fetal bovine serum (GE lifescience) and 2 mM EDTA (Ambion), added to lymphoprep tubes (Alare Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... at a concentration of 2 × 105 cells ml−1 (2 ml per dish hereafter) in DMEM (Nissui Pharmaceutical) supplemented with 10% FBS (Gibco), glutamine ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM D-Glucose, 2 mM L-Glutamine, 1 mM Sodium Pyruvate, 140 mM KCl and 20 mM HEPES, Invitrogen) for longer imaging sessions ...
-
bioRxiv - Immunology 2022Quote: ... Yeast was routinely grown in YPD broth (2% peptone [Fisher Scientific], 2% glucose [Fisher Scientific], and 1% yeast extract [Sigma]) at 30 °C for 24 hours at 200rpm ...
-
bioRxiv - Immunology 2022Quote: ... Yeast was routinely grown in YPD broth (2% peptone [Fisher Scientific], 2% glucose [Fisher Scientific], and 1% yeast extract [Sigma]) at 30 °C for 24 hours at 200rpm ...
-
bioRxiv - Developmental Biology 2024Quote: ... in facility water (2-month-old fish) or an E3 solution supplemented with 0.2 mM 1-phenyl-2-thiourea (PTU; Acros Organics) (larvae) ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: Plasma from LPS-treated mice were diluted 1:10 with Hanks’ Balanced Salt Solution (no Ca+2/Mg+2; Gibco) in 96-well black MaxiSorp™ plate ...
-
bioRxiv - Neuroscience 2024Quote: ... and EGFP with 2:2:1 (total 0.5 µg / coverslip) using the Lipofectamine 3000 transfection reagent kit (Thermo Fisher Scientific). Transfected cells were identified by EGFP signals ...
-
bioRxiv - Immunology 2024Quote: ... Yeast was routinely grown in YPD broth (2% peptone [Fisher Scientific], 2% glucose [Fisher Scientific], and 1% yeast extract [Sigma]) at 30°C for 18 hours at 200rpm ...
-
bioRxiv - Genetics 2024Quote: Metabolites from LB broth were extracted via the addition of ice cold 2:2:1 (v/v) mixture of acetonitrile:methanol:water (#A456, #A955, #W6, respectively; Thermo Fisher Scientific) at a ratio of 30 µl sample per mL of extraction solvent ...
-
bioRxiv - Biophysics 2024Quote: ... were seeded in a 6-well culture plate at a concentration of 2 x 105 cells ml-1 (2 ml per well in DMEM (Nissui) supplemented with 5 % fetal bovine serum (Gibco), glutamine ...
-
bioRxiv - Neuroscience 2021Quote: ... 2°: goat anti-mouse AF488 (1:500) (Invitrogen, A-11001), and donkey anti-rabbit Cy5 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... and ethidium homodimer-1 (2 mM in DMSO, L3224, ThermoFisher) were added directly to the cell medium to a final concentration of 1 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... stained with Neurotrace for 2 hours (1:500, N21479; Invitrogen), rinsed twice with 2x SSCT and mounted on a slide with Fluoromount-G ...
-
bioRxiv - Microbiology 2019Quote: ... N-2 supplement (1:200; catalog number 17502-048; Invitrogen), 20 ng/ml fibroblast growth factor (catalog number 4114-TC-01M ...
-
bioRxiv - Molecular Biology 2020Quote: ... and HA tag (2-2.2.14; ThermoFisher Scientific 26183, 1:10,000), used with goat anti-mouse IgG AlexaFluor®568 (ThermoFisher Scientific A-11004 ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were loaded with 1 μM fura-2 AM (Invitrogen) for 40 min before the measurements at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% Primocin (Invivogen #ant-pm-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% L-glutamine and 2% penicillin/streptomycin (Invitrogen, Paisley, UK). All cells were incubated at 5% CO2 in a humidity-controlled environment (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... transfection reagent (1:2 µg:µL ratio) in Opti-MEM (Gibco), serial diluted in 4-fold increments (1µg to 0.016µg RNA final) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2) streptavidin conjugated with Alexa Fluor488 (1:1000) (Thermofisher Science), or 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg GFP plasmid and 2 μl Lipofectamine 2000 (Thermofisher) with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separate with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separatetubes and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-E-Cadherin (Invitrogen clone ECCD-2, 1:500), rabbit anti-PH3 (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... 4,6-diamino-2-phenylindole (DAPI) dihydrochloride (1:10,000, Life Technologies) was used to counterstain the nucleus/chromosomes ...
-
bioRxiv - Genomics 2019Quote: ... 1 µl of 2 U/µl E Coli RNaseH (Invitrogen) and then incubating at 16°C for 2 hours ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of 1 U/µL alkaline phosphatase (Thermo Fisher) and 10 µL 10 x alkaline phosphatase buffer was added and incubated at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B-27 (Gibco) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 μM JC-1 dye (M34152, Thermo Fisher Scientific) at 37 °C in a 5% CO2 incubator for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and diamidino-2-phenylindole (DAPI) (1:500, Thermo Scientific, 62247).
-
bioRxiv - Microbiology 2021Quote: ... BMDMs were treated with 1 mM 2-DG (Life Technologies) dissolved in medium without glucose for 2h prior to infection ...