Labshake search
Citations for Thermo Fisher :
1901 - 1950 of 6735 citations for 6 HYDROXY 7 METHYLPURINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and plates were read using a QuantstudioTM 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Data was analyzed using the delta-delta CT method to generate box plots for a fold change of gene expression (with a fold change of 1 representing the gene expression of 100,000 hMSCs before seeding on scaffolds and composites) ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... A Quantstudio 7 Flex Real-Time PCR System with Fast SYBR Green Master Mix (Applied Biosystems) was used for the analysis ...
-
bioRxiv - Microbiology 2020Quote: ... bait concentration was adjusted to a target of 7 nM by dilution with Blocker casein (ThermoFisher) or concentration using a 30kDa MWCO Vivaspin centrifugal filter.
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was then performed using the ViiA 7 RealTime PCR System (Thermo Fisher Scientific) with a TaqMan (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4 old (7 months) male fish were dissected immediately into cold PBS (pH 7.4, Gibco). The dissected brains were fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Neuroscience 2022Quote: Primary mouse cortical neurons were transfected at DIV 7 using Lipofectamine LTX with Plus reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantification was performed by a sequence detector (ViiATM 7 Real-Time PCR System; Applied Biosystems, USA) using the TaqMan 5’ nuclease activity from the TaqMan Universal PCR Master Mix ...
-
bioRxiv - Cell Biology 2022Quote: ... 7- or 14-days post-IR sublingual glands using the RNAqueous Micro Kit (ThermoFisher Scientific, AM1931) and total RNAs were treated with DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... the solution was purified with a 7 KDa spin desalting column (ThermoFisher Scientific; Waltham, MA, USA) to obtain tetrazine-functionalized protein G (PGTz) ...
-
bioRxiv - Bioengineering 2022Quote: MCF-7 Cells were fluorescently tagged with CellTracker™ Green CMTPX dye (Invitrogen™, Waltham, MA). A stock solution of 10 mM was prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... MCF-7 WT and mutant cells were cultured in Minimum Essential Media (MEM, Thermo Fisher Scientific) with 5% fetal bovine serum ...
-
Mathematical characterization of population dynamics in breast cancer cells treated with doxorubicinbioRxiv - Cancer Biology 2021Quote: MCF-7 human breast cancer cells (ATCC HTB-22) were cultured in Minimum Essential Media (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2022Quote: ... qPCR was performed using 2× Power SYBR green reagents on the QuantStudio 7 Thermocycler (Life Technologies).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was carried out on a real-time PCR system (Thermo Fisher Scientific; QuantiStudio 7 Flex) using the following conditions ...
-
bioRxiv - Immunology 2022Quote: ... bone marrow cells were isolated and propagated for 7 days in 30% L929-conditioned RPMI (Gibco) containing 20% FCS (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7×106 cells were resuspended in 500 μl of PBS and crosslinked using formaldehyde (Thermo Fisher) at 1% final concentration ...
-
bioRxiv - Physiology 2019Quote: ... were used for quantitative real-time PCR (qPCR) analysis via a Quantstudio 7 platform (Applied Biosystems). Relative gene expression was assessed by normalizing CT values (dCT ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... PCR-amplified a ciRS-7 fragment was subcloned into pcDNA5 FRT-TO vector (Thermo Fisher Scientific) using BamHI and Xhol sites ...
-
bioRxiv - Neuroscience 2019Quote: Dead and apoptotic cells were detected using CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: The samples were then cycled in a QuantStudio 7 flex qPCR instrument (Applied Biosystems Cat# 4485701) at 50°C for 2 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 7 M urea polyacrylamide gel electrophoresis and stained with SYBR Gold (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Genetics 2019Quote: ... Neurons were harvested on day 7 and RNA was extracted using the PARIS kit from Ambion followed by TURBO DNase ...
-
bioRxiv - Synthetic Biology 2020Quote: COS-7 (ATCC® CRL-1651™) cells were cultured in DMEM medium (Thermo Fisher Scientific) supplemented with 10% FBS (fetal bovine serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were run in duplicates in ViiA™ 7 Real-Time PCR System (Thermo Fisher Scientific). 18S and β-actin served as endogenous controls (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... The real-time PCR was performed on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems), with the 2ΔΔCt method for relative quantification (Livak and Schmittgen ...
-
bioRxiv - Molecular Biology 2021Quote: Striatal ROS was marked by 2’ 7’-dichlorodihydrofluorescein diacetate (Molecular Probes™ H2DCFDA (H2-DCF, DCF), ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and qRT-PCR was run in QuantStudio 7 Flex Real-Time PCR System (Thermo-Fisher Scientific) using SYBR Green Master Mix and gene-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed in triplicate using either a QuantStudio 7 flex or QuantStudio 12K (Applied Biosystems) utilizing ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... 96 hours and 7 days post-transfection or electroporation on an Attune NxT flow cytometer (Invitrogen). For 293T BFP reporter cells ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR plates were read using a QuantstudioTM 7 Flex Real-Tim PCR System (Thermo Fisher Scientific). Results (n=5 ...
-
bioRxiv - Physiology 2020Quote: ... qRT-PCR was performed with a ViiA 7 detection system from Life Technologies (Thermo Fisher Scientific) using SYBR Green PCR master mix (Bioline) ...
-
bioRxiv - Immunology 2021Quote: ... Five minutes prior to analysis 5 μg/ml 7-amino actinomycin D (Life Technologies, CA, USA) was added for exclusion of dead cells ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR plates were read using a QuantstudioTM 7 Flex Real-Tim PCR System (Thermo Fisher Scientific) and results were analyzed using a delta-delta CT method ...
-
bioRxiv - Bioengineering 2019Quote: ... and the cells were passaged as single cells every 7 days using TrypLE Express (Life technologies). HUVECs were cultured in endothelial cell growth medium-2 (EGM-2 ...
-
bioRxiv - Genetics 2020Quote: ... The fibroblasts were replated 7 days post-infection and cultured in DMEM(Thermo Fisher Scientific,CT119955) with 10% FBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... Then 7 μL of SuperScript Master Mix (4ul 5XSSIV Buffer, 1ul 100mM DTT, 1ul RNaseOUT(Invitrogen) and 1ul SuperScriptTM IV Reverse Transcriptase (200U/ul ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Penicillin/Streptomycin and 7% of heat-inactivated fetal bovine serum (FBS) (all from ThermoFisher Scientific). VeroE6/TMPRSS2 cells (NIBSC 100978 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 minute at 60°C)] on a QuantStudio 5 or QuantStudio 7 qPCR machine (Applied Biosystems). For qPCR assessments ...
-
bioRxiv - Genomics 2021Quote: ... qRT-PCR was performed on the QuantStudio 7 Flex Real-Time PCR System (Life Technologies Corporation) with Quantitect SYBR I Green (TaKaRa Biotechnology [Dalian] Co.Ltd ...
-
bioRxiv - Physiology 2021Quote: ... and we performed qRT-PCR using RNA to Ct kit on Quant Studio 7 (Thermo Scientific) to detect gene differentially expressed in CD140+SCA1+ and CD140+SCA1-.
-
bioRxiv - Bioengineering 2022Quote: ... and cultured on Petri dishes for 7 days in Iscove’s Modified Dulbecco’s Medium (IMDM, Gibco 12440053) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... From day 7 and onwards RPMI1640 with B-27 serum free supplement with insulin (Gibco, 17504044) was used and changed every 2-3 days.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was used for relative quantification of cDNA on the ViiA 7 Real-Time PCR System (ThermoFisher) (Primer information included in Table S3).