Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Recombinant Mouse Thpo His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: Tagged diguanylate cyclases were generated by PCR amplification of each diguanylate cyclase followed by cloning into pENTR D-TOPO (ThermoFisher Scientific) and then transferred to either pRH016 (HA tag ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tagged amplicon pools were quantified using the Qubit™ 3.0 fluorometer and a Qubit™ dsDNA HS Assay Kit (Invitrogen, UK) and pooled with equimolar concentrations into a unique library ...
-
bioRxiv - Molecular Biology 2020Quote: ... mESCs were transfected with 10ug pCAG vectors encoding 2xFlag-HA-tagged BAP1 wild-type or BAP1 C91S using Lipofectamine 2000 (ThermoFisher Scientific), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were transfected with plasmid encoding Myc-tagged human NLRP3 using the Lipofectamine™ 3000 transfection kit (L3000015, Thermo fisher). At 24 h after transfection ...
-
bioRxiv - Cell Biology 2020Quote: GST pull-downs were performed by incubating purified GST tagged proteins (5 µg) with 20 μl dry volume of glutathione agarose 4B beads (Thermo Scientific) for 1 h under rotation at 4 °C ...
-
bioRxiv - Biophysics 2022Quote: ... FLAG-tagged human DNA2 nuclease-deficient (D277A) and helicase-deficient (K654R) mutants were generated by Phusion site-directed mutagenesis (Thermo Fisher) of wild-type DNA2-FLAG (pIF494 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were grown on coverslips overnight and transfected with an mGFP-tagged donor construct (GFP-SHANK3 SPN WT or GFP SHANK3 SPN R12E/K22D) and mCherry-tagged acceptor construct (mCherry-KRASG12V) using Lipofectamine® 3000 (Invitrogen) or jet PRIME (Polyplus ...
-
bioRxiv - Cancer Biology 2022Quote: ... MIA PaCa-2 cells were grown on coverslips overnight and transfected with GFP-tagged SPN WT or SPN R12E/K22D using Lipofectamine® 3000 (Invitrogen) for 24 h as described above ...
-
bioRxiv - Genomics 2022Quote: ... The human urothelial bladder tumor cells were transfected with the doxycycline-inducible GFP-tagged APOBEC3G vector and the PiggyBac transposase vectors with the Lipofectamine2000 transfection agent (ThermoFisher Scientific). G418 was used for the selection of the clones with stable genomic insertion of the GFP-tagged APOBEC3G component ...
-
bioRxiv - Systems Biology 2022Quote: ... Individual wells were transfected with 25ng of plasmid expressing one tagged Parkin variant using a Lipofectamine 3000 kit (Invitrogen, L3000-015) via manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... HEK 293T cells were transiently transfected with 5 µg of FLAG tagged full-length HRI construct and 5 µg of GFP tagged DELE1 constructs (DELE1CTD or mutants) using Lipofectamine 3000 transfection reagent (L3000008, ThermoFisher Scientific). GFP empty vector was used as a negative control ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by secondary antibody-staining with Alexa 546-tagged Goat Anti-rat IgG (catalog no. A-11081, Thermo Fisher Scientific, USA). The detailed immunostaining protocol is available upon request.
-
bioRxiv - Neuroscience 2022Quote: ... 2 × 5 min) and incubated with secondary antibody (AlexaFluor 488-tagged goat anti-rabbit Ab, 1:1000, ThermoFisher Scientific, A-11008) and with Alexa Fluor 633-conjugated Streptavidin (1:400 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... H10,14,243F GPR65 or B2AR N-terminally tagged with FLAG were cultured in DMEM high glucose (Cytiva, SH3024301) supplemented with 10% fetal bovine serum (FBS; Gibco, 26140079). Stable cell lines expressing one of the constructs were generated using Geneticin (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... HA-tagged CDPK1 in the cWT and cMut lines was visualized with secondary goat antibodies (1:2000, 1 hr; Life Technologies) conjugated to Alexa Fluor 594 and 488 ...
-
bioRxiv - Neuroscience 2023Quote: ... Slides were washed twice with filtered PBS and then incubated with AlexaFluor 555-tagged donkey-anti-rabbit (Molecular Probes, 1:1000) and AlexaFluor 488-tagged donkey-anti-mouse (Molecular Probes ...
-
bioRxiv - Cell Biology 2023Quote: Methods used for these assays have been described.28 Briefly, human FLAG-tagged CDKL5 WT or kinase dead (KD, CDKL5 K42R) constructs were subcloned into pT7CFE1-CHis plasmid (Thermo Fisher). These constructs were then used for in vitro translation using a HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 5 min with 25 pM (single-label) or 5 pM (dual-label) biotin-tagged α-FLAG monoclonal antibody (ThermoFisher Scientific #MA1-91878-BTIN ...
-
bioRxiv - Genetics 2023Quote: ... We used Gibson Assembly to add a 3x FLAG tag to the appropriate end and insert the tagged coding sequence into a pcDNA5/FRT vector (Thermo Fisher). We note that we overexpressed the propeptide of PSMB4 (removing amino acids 2-45).
-
bioRxiv - Molecular Biology 2023Quote: ... or 90 pmol of SBP-tagged eIF4A1 protein was incubated with 30 μl of Dynabeads M-270 Streptavidin (Thermo Fisher Scientific), which had been preequilibrated with equilibration buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biophysics 2023Quote: Dextran-tagged Rhodamine-B (Rhod-Dex) with 10,000 Da and 70,000 Da molecular weights were from Invitrogen (Invitrogen 11466337 and 11590226). Mouse pre-osteoblast cells were cultured on 400 nm porous and non-porous surfaces in a 96-well plate 24 hours before the incubation with Rhod-Dex ...
-
bioRxiv - Developmental Biology 2023Quote: Fifty wildtype or myc-tagged Sox3 expressing animal pole cell explants were crosslinked for 15 minutes with 1% methanol-free formaldehyde (Life Technologies) and the reaction was quenched with 125 mM glycine in 0.5% PBST (Triton X-100) ...
-
Identification of plants functional counterparts of the metazoan Mediator of DNA Damage Checkpoint 1bioRxiv - Cell Biology 2023Quote: ... GST-tagged proteins (5 µg) along with GST alone were incubated with 10 µl of magnetic glutathione beads (Thermo Fisher Scientific) for one hour at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... FLAG-tagged WT or kinase dead (KD, CDKL5 K42R) constructs of human CDKL5 were subcloned into a pT7CFE1-CHis plasmid (Thermo Fisher). A HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... 24 hours later cells were transfected with 2 ug DNA (mCherry tagged PPP1R15A DNA and empty carrier DNA at a ratio of 1:19) using the lipofectamine LTX system (Life Technologies) at a ratio of 3 μl lipofectamine LTX to 1 μl Plus reagent for every nanogram of DNA in 200 μl of Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... Western blotting and immunodetection of HA-tagged proteins with anti-HA and horse radish peroxidase-coupled secondary antibodies using an iBright™ FL1500 (ThermoFisher). The remaining 25 µl bead suspension was used as input for on-bead digestion (Klaus et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The ORF of red fluorescent protein gene (RFP)-fused Antp was inserted into a pIZ/V5-His vector (Invitrogen) driven by the OpIE2 promoter ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the C-terminal foldon trimerization motif followed by an 8×His-tag was cloned into the pcDNA3.1(+) expression vector (Invitrogen). Furthermore ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... extended with a nucleic acid sequence encoding for 6 histidine residues (His-tag) and cloned into the mammalian expression vector pcDNA3.1(+) (Invitrogen). The soluble antigen was produced by transient gene expression in CHO cells as described previously [38] and purified from the cell culture medium by Ni-NTA resin (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder, Applied Biosystems, in 10 μL of Hi-Di formamide ...
-
bioRxiv - Biochemistry 2020Quote: ... the magnetic beads were resuspended in 10.0625 μL ROX/Hi-Di (0.0625 μL of ROX 350 ladder [Applied Biosystems] in 10 μL of Hi-Di formamide [Applied Biosystems] ...
-
bioRxiv - Biochemistry 2020Quote: ... Purified PCR products were digested with XhoI and NheI and inserted into the pcDNA6/V5-His expression vector (Invitrogen) generating plasmid pMBA40 for POMGNT1 complementation ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA libraries were pooled for emulsion PCR using an Ion PI Hi-Q Chef Kit (Thermo Fisher Scientific). The enriched samples were loaded onto an Ion PI chip v3 with Ion Chef ...
-
bioRxiv - Genomics 2021Quote: ... Sequencing was performed on the Ion Torrent PGM with the Ion PGM Hi-Q View Sequencing kit (Life Technologies) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 (438-516) S-RBD((HiS)6 and biotynilated human ACE2 have been purchased from Fisher Scientific (respective references 16534204 and 16545164) ...
-
bioRxiv - Microbiology 2020Quote: ... the RNA-Seq templates were prepared using the Ion PGM Hi-Q View OT2 Kit (Thermo Fisher Scientific Inc.) on an Ion OneTouch 2 system ...
-
bioRxiv - Microbiology 2020Quote: 293F cells were transfected by plasmids pOptiVec/V5-His WEAU gp120-trimer using 293fectin according to the manufacturer’s (Invitrogen) instructions ...
-
bioRxiv - Immunology 2022Quote: ... Splenocytes were stored down by resuspending cells in freezing media (HI-FBS with 10% DMSO, Fisher Scientific, BP231-100) in aliquots of 5-10 x106 cells per ml and frozen down to -80°C at a speed of 1°C/min prior to storage in liquid nitrogen.
-
bioRxiv - Immunology 2022Quote: ... and C-terminal foldon trimerization motif followed by hexa-His tag) were used to transiently transfect Expi293F cells (Gibco). Four days after transfection ...
-
bioRxiv - Immunology 2022Quote: ... two alpacas were five times immunized with 200 µg His-NLRP1PYD using Imject™ Alum Adjuvant (Thermo Fisher Scientific) according to locally authorized protocols ...
-
bioRxiv - Plant Biology 2022Quote: ... fused with an N-terminal 6×His-tag and cloned into expression vector pPIC9 (Thermo Fisher Scientific, California, USA). Correctness of the resulting constructs was confirmed by DNA sequencing prior to introduction into Pichia pastoris strain GS115 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Protein expression was confirmed by western blot using a 6x His-Tag HRP conjugated Monoclonal Antibody (Thermo Fisher Scientific). Once verified ...
-
bioRxiv - Biochemistry 2021Quote: ... the membranes were incubated 1 mg L-1 of anti-6X-His tag monoclonal antibody [HIS.H8] with an HRP conjugate (ThermoFisher) suspended in 10 mL 1X TBST for 0.5 hours ...
-
bioRxiv - Systems Biology 2022Quote: HeLa cells and FUCCI -HeLa cells were cultured in DMEM medium (Hi Media, AT007) supplemented with 10% FBS (Gibco) and 1% Penicillin-Streptomycin (Hi Media, ...
-
bioRxiv - Molecular Biology 2019Quote: ... The lysate including his-FAP-interacting peptides were collected and submit to a MS facility (Thermo Fisher, Inc.; USA) for analysis ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA4-V5-NAA80-M23L was constructed by subcloning NAA80 from pcDNA3.1-NAA80-V525 into the TOPO TA vector pcDNA 4/Xpress-His (Invitrogen). Then the M23L mutation was introduced and the N-terminal Xpress tag was replaced with a V5 tag ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 228-10481) cDNA was cloned into the BamHI-NotI of the pcDNA3.1(+)-myc-His expression vector (Invitrogen, CAT# V80020) yielding pcDNA3.1-BRCA2T (BRCA2/2662T) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The first round PCR reaction was performed by adding 1 µl of cDNA template to a 20 µl reaction containing 0.005 U of Platinum Taq Hi-Fidelity polymerase (Invitrogen) as previously described (59) ...
-
bioRxiv - Microbiology 2020Quote: ... An aliquot of 50 ng of purified HIV-1 env DNA was used to clone into the pcDNA 3.1D/V5-His-TOPO vector (Invitrogen) and MAX Efficiency Stlb2 competent cells (Life Technology ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...