Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for Rat Corticosteroid 11 Beta Dehydrogenase Isozyme 2 HSD11B2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Immunology 2023Quote: ... ULBP6 (Hs04194671_s1) and beta actin (Hs99999903_m1) with TaqMan MGB probes all conjugated with fluorochrome FAM (Thermofisher). The cycling conditions were 50°C for 2 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... Beta-Mercaptoethanol Thermo Fisher Scientific 21985023) with a SMAD inhibitor (SB-431542 Fisher Scientific 16-141) and WNT activator (CHIR-99021 Fisher Scientific S12632) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were then incubated with 3X cholesterol or 5mM methyl beta cyclodextrin (MßC) (#377110050, Thermo Fisher) (doses chosen for biological effectiveness but minimal cellular toxicity [Supplementary Figures 2 and 3] ...
-
bioRxiv - Cell Biology 2020Quote: ... Neurons were then transfected at 9–11 days in vitro with Lipofectamine 2000 (Thermo Fisher). 500 ng of total DNA (100 ng ASAP3-RFP and 400 ng pcDNA3 ...
-
bioRxiv - Biophysics 2020Quote: MCF10A cells (ATCC) were maintained in DMEM/F12 medium (Thermo Fisher Scientific 11-330-057) with 5% horse serum (Thermo Fisher Scientific 26050088 ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Cells were grown for 11 days in knockout serum replacement medium (KSR; Gibco, 10828-028) containing advanced DMEM/F12 (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... P-gp-overexpressing subline KB-8-5-11 were maintained in DMEM (Thermofisher catalog #11965) with 10% FBS and 1% penicillin/streptomycin at 37°C in 5% CO2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cells were stained with human FITC conjugated transferrin receptor (CD71; ThermoFisher: 11-0719-42) and human FITC conjugated glycophorin A (CD235a ...
-
bioRxiv - Immunology 2020Quote: ... USA) (Procartaplex human th1/th2 cytokine panel 11 plex from Invitrogen, cat # epx110-10810-901) per the manufacturers’ instruction.
-
bioRxiv - Cell Biology 2022Quote: Primary mouse islet cells were maintained in RPMI 1640 medium containing 11 mM glucose (Gibco), 10% (v/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 100 units/ml penicillin and 100 μg/ml streptomycin and 11 mM HEPES (GIBCO 15630056), plus 50% rat serum (rat whole embryo culture serum ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... isolated total nucleic acid concentration was measured using a NanoDrop DeNovix DS-11 (Thermo Fisher) and diluted to 100 ng/μL in 50 μl DNase/RNase-free H2O ...
-
bioRxiv - Bioengineering 2023Quote: ... The pH measurements were performed by a micro-pH electrode (Fisher Scientific, 11-747-328). To prepare the 20× LAMP primer mix ...
-
bioRxiv - Cell Biology 2023Quote: ... RIMVEC-11 cells were cultured in Dulbecco’s modified Eagle’s medium (Thermo Fisher Scientific, Marina, USA) supplemented with 10% (vol/vol ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-Cd27 Monoclonal Antibody (LG.7F9) FITC (eBioscience™, Thermo Scientific, cat # 11-0271-82), and (Klrg1 Monoclonal Antibody (2F1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then sectioned (11 μm) with a Microm HM 340E microtome (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: CAFs were seeded on 11 kPa PAA gel with red beads (580/605, Invitrogen, F8810) and cultured in DMEM medium containing 10% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... HPAF-II cells were cultured in Minimum Essential Medium (MEM, 11-095-080, Fisher Scientific) containing 1% sodium pyruvate (11360070 ...
-
bioRxiv - Cell Biology 2023Quote: ... The absolute number of enucleated cells was measured on day 11 using Hoescht 33342 (Invitrogen; cat ...
-
bioRxiv - Developmental Biology 2023Quote: DFC were stained with the fluorescent dye SYTO 11 (cat# S7573, Invitrogen, Carlsberg, CA, USA) as described by Cooper and D’Amico (1996) ...
-
bioRxiv - Molecular Biology 2023Quote: ... CD43 (1:200, BD Pharmingen 562865; S7, or Thermo Fisher 11-0431-85; eBioR2/60), and CD21 (1:500 ...
-
bioRxiv - Cell Biology 2024Quote: ... 11 µl per sample of Dynabeads® M-280 sheep anti-mouse IgG (Thermo Fisher) were collected with a magnetic rack and pre-washed with 500 µl PBS-BSA (1 mg/ml BSA in 0.1 M PBS ...
-
bioRxiv - Pathology 2021Quote: ... Relative mRNA levels were determined by the comparative cycle threshold method with normalization to glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Thermo Fisher Scientific, Inc.).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Bioengineering 2019Quote: ... and cryostat section (10μm) were stained using the following antibodies: rat anti-IL2 (eBioscience 14-7029-85) and anti-rat AlexaFluor488 (Invitrogen A21208). For vascular staining goat anti-CD31 (R&D AF3628 ...
-
bioRxiv - Bioengineering 2019Quote: Antigen expression was confirmed on ice-cold acetone fixed 8-μm cryostat sections of SKRC52 and CT26-CAIX stained with IL2-XE114-TNFmut and IL2-F8-TNFmut (final concentration 5μg/mL) and detected with rat anti-IL2 (eBioscience 14-7029-85) and anti-rat AlexaFluor488 (Invitrogen A21208). For vascular staining goat anti-CD31 (R&D AF3628 ...
-
bioRxiv - Biophysics 2020Quote: Primary rat cortical neurons (RCN) prepared from the cortex of day-18 rat embryos (A10840-01, Life Technologies, Gaithersburg, MD) were suspended in a culture medium (21103-049 ...
-
bioRxiv - Immunology 2021Quote: ... Macrophages were positively enriched from spleen single-cell suspensions using anti-F4/80 antibody (rat, Bioscience, Clone T45-2342)-coated Dynabeads (anti-rat IgG, Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... Cells were then washed and incubated with anti-rat Ab magnetic beads at 1 bead/target cell for 40 min at 4C (Dynabeads sheep anti-rat IgG, Invitrogen). Cell suspensions were stained with Abs specific for congenic markers ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then washed and incubated with anti-rat Ab magnetic beads at 1 bead/target cell for 40 min at 4C (Dynabeads sheep anti-rat IgG, Invitrogen). Cells were sorted into 3mL of complete media (RPMI 1640 ...
-
bioRxiv - Developmental Biology 2023Quote: ... using rat-anti-BrdU (1:500, OBT0030 Accurate) and donkey-anti-rat Alexa Fluor-568-conjugated secondary antibody (1:1000, Invitrogen).
-
bioRxiv - Immunology 2019Quote: ... Samples were washed thrice with blocking buffer and incubated for 2 hr with anti-rat Alexa Fluor® 488- and anti-rabbit Alexa Fluor® 594-conjugated secondary antibodies (ThermoFisher Scientific, 1:400). After washing ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were washed in PBS and incubated for 2 hours at room temperature in a donkey anti-rat secondary antiserum (1:500; Alexa Fluor 594, Thermo Fisher Scientific, Cat.#: A-21209). Last ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were then incubated in 500 μL of primary antibody solution containing rat anti-alpha-tubulin YL1/2 (MA1-80017, Invitrogen, CA, SAD, diluted 1:500) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2021Quote: Nuclear fractions from ipsilateral sciatic nerve injury sites from each rat were isolated with a NE-PER Nuclear and Cytoplasmic Extraction Kit (ThermoFisher Scientific), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Fasting glucose level (measured with a glucometer; Bayer, Leverkusen, Germany) and fasting insulin level (insulin mouse ELISA kit, Thermo Fisher Scientific, Waltham, MA, USA) were measured in fasted mice.
-
bioRxiv - Molecular Biology 2022Quote: ... TGF-β1 and monocyte chemotactic protein-1 (MCP-1) was measured using the ELISA kit following the manufacturer’s protocol (eBioscience Affymetrix, Santa Clara,CA, United States). The levels of Muc5ac and Muc5b in BALF were also measured according to Lu et al ...
-
bioRxiv - Immunology 2021Quote: Supernatants from 48-hour rested and stimulated iNKT cells and TCONV were assayed for cytokine levels of IFN-γ using human ELISA kit (Invitrogen cat #88-7316) following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: TNF-α was quantified in cell culture supernatants of infected cells by Ready-SET-Go! ELISA kits (Thermo Fisher Scientific, Cat. 88-7324-77) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The total immunoglobulin E (IgE) level in the serum samples was measured using an IgE mouse ELISA kit (Thermo Fisher Scientific, Waltham, Mass, USA) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 10 μgs of protein were loaded into manually coated IL-22 96-well High Affinity plates and IL-22 levels were determined by IL-22 ELISA kit (ThermoFisher-Scientific #88-7422-22) following manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... and goat anti-rat 568 (Invitrogen, cat #A11077) antibodies in a dark humidified chamber for one hour at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... and anti-rat conjugated to Alexa647 (Thermofisher, A21472). Alexa568 conjugated phalloidin (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-mCherry (Thermo Fisher, M11217, 1:500), rabbit anti-Halotag (Promega ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and anti-rat Alexa 488 (Invitrogen, A-11006) (1 μg/mL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and goat anti-rat 647 (#A-21247; Invitrogen). Nuclei were stained with DAPI (1:1000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... A goat α-rat Alexa488 secondary antibody (Invitrogen) was used at 1:1,000 in blocking solution and nuclei stained with DAPI.
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-rat Alexa546 (1:500; Invitrogen A11081) and TRITC-phalloidin (1:100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... rat α-mCherry (Thermo Fisher Scientific, M11217, RRID:AB_2536611); rabbit α-MPP8 (Proteintech ...