Labshake search
Citations for Thermo Fisher :
1851 - 1900 of 10000+ citations for 6 Bromo 2 trifluoromethyl 3H imidazo 4 5 b pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 1.5 μL of cholera toxin subunit B (CTB) conjugated with Alexa Fluor 594 (2 mg/ml, Thermo Fisher Scientific) was injected into the right vitreous humors of the same mice (same procedure as viral injection ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were gavaged with a 2% methylcellulose mixture containing 2.5 mg/mL Rhodamine B Dextran (Invitrogen, D1841, MW: 70,000). 15 minutes after gavage ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... were incubated for 4 h in DMEM/F12 containing 5% horse serum (Gibco) and 5% foetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA (5 μg) was separated in 4-20% TBE gel (ThermoFisher scientific), described above.
-
bioRxiv - Microbiology 2021Quote: ... 14.5 μl of preheated reaction mixture [4 μl First Strand buffer (5 ×, Invitrogen), 1 μl 0.1 M dithiothreitol ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Pathology 2021Quote: ... washed platelets were stained with Fluo-4 AM (5 μM, Thermo Fisher Scientific) for 30 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... which included 5 µL 4× Taqman Fast Advanced Master Mix (Thermo Fisher Scientific), 0.4 µL of each primer (tat 2.0 and rev ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were loaded with 5 μM of Fluo-4-AM (Thermo Fisher Scientific) for 50 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 for 4 minutes and resuspended in E8 medium (Thermo Fisher Scientific) and 10 μM Y-27632 Rho-kinase inhibitor (ROCKi ...
-
bioRxiv - Bioengineering 2023Quote: ... calcium imaging was performed using 5 μM Fluo-4-AM (ThermoFisher, F14201, US) in Krebs-Ringer’s solution containing NaCl 119 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Immunology 2022Quote: ... 0.1 mM EDTA) for 5 minutes at room temperature and then neutralized with B cell media (RPMI 1640 with L-glutamine (Gibco) supplemented with 15% fetal bovine serum (Corning) ...
-
bioRxiv - Genetics 2022Quote: ... Hygromycin-resistant colonies emerging on the surface of the overlay after 3–5 days were excised and transferred to MEA amended with 100 µg/mL of hygromycin B (Invitrogen) (MEA+Hyg100) ...
-
bioRxiv - Immunology 2021Quote: ... Qβ-VLPs were then re-packaged with B-type 1668 CpGs (5″-TCC ATG ACG TTC CTG ATG CT-3″) with phosphorothioate backbone purchased from (InvitroGen). The re-packaging was confirmed by 1% agarose gel stained with SYBR Safe dye for 30min at 90V ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cultured at 5% O2 in Dulbecco’s modified essential medium (DMEM)/F12 with B-27 minus vitamin A (Life Technologies), 1% penicillin-streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... Tenfold dilutions were used to infect confluent Vero E6 cells in a 96-well plate in MEM (5% FBS, 1% penicillin-streptomycin, 1% kanamycin, 3% amphotericin B (Gibco)) at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cultures were maintained in NGM (500 ml Neurobasal-A Medium, 10 ml B-27, and 5 ml Glutamax, from Gibco, ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Cultures were maintained in NGM (500 ml Neurobasal-A Medium, 10 ml B-27, and 5 ml Glutamax, from Gibco, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: The murine CH27 B-cell lymphoma line was cultured at 37°C and 5% CO2 in 1640 RPMI (Life technologies) supplemented with 10% FCS (Biowest) ...
-
bioRxiv - Physiology 2023Quote: ... was incubated with 5 µl Zenon component A solution for five minutes and then with 5 µl Zenon component B solution (ZenonTM Mouse IgG1 Labeling Kit Z-25006, Alexa Fluor 568, Invitrogen). PBS with 0.1% triton was added to the Zenon-labeled antibody mix to a final 1:75 dilution ...
-
bioRxiv - Systems Biology 2023Quote: ... Val-Tyr-Val, methoxyamine hydrochloride (MeOX), N-methyl-N-(trimethylsilyl)-trifluoroactamide (MSTFA), and pyridine (Anhydrous, 99.8%) were all purchased from Fisher Scientific (Hampton, NH, USA). Fatty acid methyl esters (FAMEs ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: Ramos B Cells at a concentration of 10 million cells/mL were incubated with 10 μM Fluo-4 AM (ThermoFisher, Inc.) for 30 minutes at 37C ...
-
bioRxiv - Biochemistry 2023Quote: ... and eluted at 200 nl/min over either linear 140 min gradient 4-40% buffer B (0.1 % FA in ACN, Thermo Scientific 85174), or 195 min concave gradient (4-30% ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 X 105 PC3 or MCF7 cells were plated in either 6 well culture dishes (Nunc™ ...
-
bioRxiv - Molecular Biology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI) for nuclear staining (Fluoromount-G™ Mounting Medium, with DAPI, Invitrogen), and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... 50 μL of 2-6 μg/mL S was plated onto 384-well Nunc Maxisorp (ThermoFisher) plates in PBS and sealed overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... and Type 6 primary probes targeting MYCN were designed and synthesized by Affymetrix (Supplementary Table 2). Hybridization was performed according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed twice with PBS and stained with Laurdan dye (6-dodecanoyl-2- dimethylaminoaphthalene) (Thermofisher) at 10 µM for 45 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 μg of reporters were transfected into cells in 6 well plate using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse 5’-CGA AGG TGT GAC TTC CATG-3’) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). A standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Microbiology 2019Quote: ... 5 to 6 seeds were pipetted into 120 x 120 mm square petri dishes (Thermo Fisher Scientific) containing half-strength Murashige and Skoog salts (MS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... real-time quantitative PCR was done using the ABI Quant Studio 5 and 6 (Life technologies, USA). The cDNA was used as template and DyNAmo Flash SYBR Green qPCR kit (#F-416L ...
-
bioRxiv - Cell Biology 2022Quote: ... about ∼5 μg of bacmid were transfected using 6 μl of Cellfectin II reagent (Thermo Fisher Scientific). 5 days after initial transfection ...
-
bioRxiv - Immunology 2021Quote: ... Sorted memory CD4+ T cells were labelled with 5-(and 6)-carboxyfluorescein diacetate succinimidyl ester (CFSE, ThermoFisher) and cultured at a ratio of 2:1 with irradiated autologous monocytes untreated or pulsed for 3 h with recombinant SARS-CoV-2 Spike protein (2.5 μg/ml) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfection with 5 ug total DNA in a 6 well plate was performed using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... 6-well culture plates) for 8 days at 37°C and 5% CO2 in RPMI1640 (Life technologies) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with B-27 either with or without Insulin (RPMI/B-27 +/−) (Life Technologies) depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences) ...
-
bioRxiv - Cell Biology 2019Quote: ... For the visualization of Cathepsin B active compartments MagicRed cathepsin B substrate (Molecular Probes) was using in a 1:260 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were centrifuged at 14,000g for 5 minutes at 4°C and electrophoresed on NuPAGE™ 4-12% Bis-Tris Polyacrylamide gels (Thermo Fisher) with NuPAGE™ MOPS running buffer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa cells were transfected with the indicated plasmids for 3h in serum depleted medium (Opti-MEMTM, ThermoFisher) using lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...